CBF, CBF (gene) Prunus davidiana

Gene Overview
Name CBF
Gene Symbol CBF
Type gene
Organism Prunus davidiana
Synonym C-repeat binding factor
Description NA
Comment transcription factor which regulates the plant adaptability under cold temperature
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFJX464666.1-CBFPrunus davidianagene
CBFJX464665.1-CBFPrunus davidianagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFJX464666.1-CBF.m1Prunus davidianamRNA
CBFJX464665.1-CBF.m1Prunus davidianamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFPrunus davidianagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JX464666.1-CBF scaffold_5:10051647..10052367
JX464666.1
gene parsed from NCBI nr database JX464665.1-CBF scaffold_5:10051647..10052367
JX464665.1
mRNA parsed from NCBI nr database JX464666.1-CBF.m1 scaffold_5:10051647..10052367
JX464666.1
mRNA parsed from NCBI nr database JX464665.1-CBF.m1 scaffold_5:10051647..10052367
JX464665.1

Sequence(s):
>JX464666.1-CBF720
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcccaggtcgagttcgtcatccgacgcaagcgt
gaccaccctacgcacttcggacgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggagggttttcaaagaga
cgaggcacccggtttataggggtgtgaggaggagagacaacaacaagtgggtgtgtgagttgagacagcccaacaagaag
aagtccgggatttggctcggaacctatcctacggctgagatggctgctcgtgcccatgacgtggcggcattggcttttaa
agggaagcttgcctgcctcaactttgctgactcgggttggcggctgccggtggcggcatccatggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggtggagtttccagcggcagcagtgatgagaag
gagagaatggttgtggtggaagagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagcagattaaactt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgacaacatggctgaagggcttcttctttctccac
cgcaatgcttagctggctatttgaattgggatgacatggaaactgaagctgatcccaagttgtggagcttctctatctga
back to top
>JX464665.1-CBF720
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcccaggtcgagttcgtcatccgacgcaagcgt
gaccaccctacgcacttcggacgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggagggttttcaaagaga
cgaggcacccggtttataggggtgtgaggaggagagacaacaacaagtgggtgtgtgagttgagacagcccaacaagaag
aagtccgggatttggctcggaacctatcctacggctgagatggctgctcgtgcccatgacgtggcggcattggcttttaa
agggaagcttgcctgcctcaactttgctgactcgggttggcggctgccggtggcggcatccatggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggtggagtttccagcggcagcagtgatgagaag
gagagaatggttgtggtggaagagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagcagattaaactt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgacaacatggctgaagggcttcttctttctccac
cgcaatgcttagctggctatttgaattgggatgacatggaaactgaagctgatcccaagttgtggagcttctctatctga
back to top
>JX464666.1-CBF.m1720
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcccaggtcgagttcgtcatccgacgcaagcgt
gaccaccctacgcacttcggacgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggagggttttcaaagaga
cgaggcacccggtttataggggtgtgaggaggagagacaacaacaagtgggtgtgtgagttgagacagcccaacaagaag
aagtccgggatttggctcggaacctatcctacggctgagatggctgctcgtgcccatgacgtggcggcattggcttttaa
agggaagcttgcctgcctcaactttgctgactcgggttggcggctgccggtggcggcatccatggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggtggagtttccagcggcagcagtgatgagaag
gagagaatggttgtggtggaagagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagcagattaaactt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgacaacatggctgaagggcttcttctttctccac
cgcaatgcttagctggctatttgaattgggatgacatggaaactgaagctgatcccaagttgtggagcttctctatctga
back to top
>JX464665.1-CBF.m1720
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcccaggtcgagttcgtcatccgacgcaagcgt
gaccaccctacgcacttcggacgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggagggttttcaaagaga
cgaggcacccggtttataggggtgtgaggaggagagacaacaacaagtgggtgtgtgagttgagacagcccaacaagaag
aagtccgggatttggctcggaacctatcctacggctgagatggctgctcgtgcccatgacgtggcggcattggcttttaa
agggaagcttgcctgcctcaactttgctgactcgggttggcggctgccggtggcggcatccatggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggtggagtttccagcggcagcagtgatgagaag
gagagaatggttgtggtggaagagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagcagattaaactt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgacaacatggctgaagggcttcttctttctccac
cgcaatgcttagctggctatttgaattgggatgacatggaaactgaagctgatcccaagttgtggagcttctctatctga
back to top