CBF, CBF (gene) Prunus mira

Gene Overview
Name CBF
Gene Symbol CBF
Type gene
Organism Prunus mira
Synonym C-repeat binding factor
Description NA
Comment transcription factor which regulates the plant adaptability under cold temperature
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFJX464664.1-CBFPrunus miragene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFJX464664.1-CBF.m1Prunus miramRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFPrunus miragene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JX464664.1-CBF scaffold_5:10051647..10052367
JX464664.1
mRNA parsed from NCBI nr database JX464664.1-CBF.m1 scaffold_5:10051647..10052367
JX464664.1

Sequence(s):
>JX464664.1-CBF720
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcccaggtcgagttcgtcatccgacgcaagcgt
gaccaccctacgcacttcggacgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggagggttttcaaagaga
cgaggcacccggtttataggggtgtgaggaggagagacaacaacaagtgggtgtgtgagttgagacagcccaacaagaag
aagtccgggatttggctcgggacctatcctacggctgagatggctgctcgtgcccatgacgtggcggcattggcttttaa
agggaagcttgcctgcctcaactttgctgactcgggttggcggctgccggtggcggcatccatggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcaggccagtggagtttggtggagttaccagcggcagcagtgatgagaag
gagagactggttgtggtggaagagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagcagattaaactt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgacaacatggctgaagggcttcttctttctccac
cccaatgcttagctggctatttgaattgggatgacatgggaactgaagctgatcccaagttgtggagtttctctatctga
back to top
>JX464664.1-CBF.m1720
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcccaggtcgagttcgtcatccgacgcaagcgt
gaccaccctacgcacttcggacgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggagggttttcaaagaga
cgaggcacccggtttataggggtgtgaggaggagagacaacaacaagtgggtgtgtgagttgagacagcccaacaagaag
aagtccgggatttggctcgggacctatcctacggctgagatggctgctcgtgcccatgacgtggcggcattggcttttaa
agggaagcttgcctgcctcaactttgctgactcgggttggcggctgccggtggcggcatccatggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcaggccagtggagtttggtggagttaccagcggcagcagtgatgagaag
gagagactggttgtggtggaagagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagcagattaaactt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgacaacatggctgaagggcttcttctttctccac
cccaatgcttagctggctatttgaattgggatgacatgggaactgaagctgatcccaagttgtggagtttctctatctga
back to top