CBF, CBF (gene) Prunus persica

Gene Overview
Name CBF
Gene Symbol CBF
Type gene
Organism Prunus persica
Synonym C-repeat binding factor
CBF/DREB 6
CBF/DREB 5
CBF/DREB 4
CBF/DREB 3
CBF/DREB 2
CBF/DREB transcription factor
DREB 5
DREB 3
DREB 6
DREB 2
DREB 4
DREB
Description NA
Comment AP2 domain transcription activator
AP2/ERF transcription factor family; low temperature response pathway
transcription factor which regulates the plant adaptability under cold temperature
PpCBF1
C-repeat/dehydration-responsive element binding factor; CBF/DREB transcription factor; contains AP2 and EREBP (ethylene responsive element binding protein)
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFJX464668.1-CBFPrunus persicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFKC885952.1-CBF.m1Prunus persicamRNA
CBFKC543502.1-CBF.m1Prunus persicamRNA
CBFKC543501.1-CBF.m1Prunus persicamRNA
CBFKC543500.1-CBF.m1Prunus persicamRNA
CBFKC543499.1-CBF.m1Prunus persicamRNA
CBFKC543498.1-CBF.m1Prunus persicamRNA
CBFJX464668.1-CBF.m1Prunus persicamRNA
CBFHM992943.1-CBF.m1Prunus persicamRNA
CBFHM228387.1-CBF.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JX464668.1-CBF scaffold_5:10051647..10052367
JX464668.1
mRNA parsed from NCBI nr database KC885952.1-CBF.m1 scaffold_2:24801244..24801934
KC885952.1
mRNA parsed from NCBI nr database KC543502.1-CBF.m1 scaffold_2:24801244..24801934
KC543502.1
mRNA parsed from NCBI nr database KC543501.1-CBF.m1 scaffold_5:10085520..10086243
KC543501.1
mRNA parsed from NCBI nr database KC543500.1-CBF.m1 scaffold_5:10060831..10061530
KC543500.1
mRNA parsed from NCBI nr database KC543499.1-CBF.m1 scaffold_5:10059062..10059773
KC543499.1
mRNA parsed from NCBI nr database KC543498.1-CBF.m1 scaffold_5:10054607..10055300
KC543498.1
mRNA parsed from NCBI nr database JX464668.1-CBF.m1 scaffold_5:10051647..10052367
JX464668.1
mRNA parsed from NCBI nr database HM992943.1-CBF.m1 scaffold_5:10051647..10052367
HM992943.1
mRNA parsed from NCBI nr database HM228387.1-CBF.m1 scaffold_5:10054607..10055300
HM228387.1

Sequence(s):
>JX464668.1-CBF720
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcccaggtcgagttcgtcatccgacgcaagcgt
gagcaccttacgcacttcggacgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggaaggttttcaaagaga
cgaggcacccggtttataggggtgtgaggaggagagacaacaacaagtgggtgtgtgagttgagacagcccaacaagaag
aagtccgggatttggctcgggacctatcctacggctgagatggctgctcgtgcccatgacgtggcggcattggcttttaa
agggaagcttgcctgcctcaactttgctgactcgggttggcggctgccggtcgcggcatccatggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggtggggtttccagcggcagcagtgatgagaag
gagagaatggttgtggtggaagagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagcagattaaactt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgacaacatggctgaagggcttcttctttctccac
cccaatgcttagctggctatttgaattgggatgacatggaaactgaagctgattccaagttgtggagtttctctatctga
back to top
>KC885952.1-CBF.m1690
atggatggtttttgtccttactacgtcgacccacaaacttgtggcgcctcctccgaggtaccggaatcttcgtccgcttc
cgacaacagcagtgctcgccctgtatccgtgaacttttcggacgaggagctcctgctggcgtccacttatcccaagaagc
gggccggtcggaagaagttcaaggagactcggcaccccgtgtaccgcggtgtcaggagaaggaactccgggaagtgggtt
tgcgaggtgcgggagcccaacaagaagaccaggatttggctcgggactttccccacagccgaaatggcagcgcgagctca
tgacgtggcggccatcaagctcagaggtcggtctgcttgcttgaactttgccgactccgcgtggcggctgcctgtcccgg
cttcagcaaacgccaaggatattcaaaccacagcttccgaggctgctgaggcgtttcggccacctgcggaggggtcggtt
gaggtttctggagcttcggcggtggccgcgtcagaaagcaagtcagcatcggaacaagtgttttatatggatgaggaggc
tgtttttgggatgccaggactcctcgcaaatatggccgaagggatgctgttgtctccacctctttacaccgaggatgacg
atgacgtggaattttatgctgacgtgccactatggagttattcgatttaa
back to top
>KC543502.1-CBF.m1690
atggatggtttttgtccttactacgtcgacccacaaacttgtggcgcctcctccgaggtaccggaatcttcgtccgcttc
cgacaacagcagtgctcgccctgtatccgtgaacttttcggacgaggagctcctgctggcgtccacttatcccaagaagc
gggccggtcggaagaagttcaaggagactcggcaccccgtgtaccgcggtgtcaggagaaggaactccgggaagtgggtt
tgcgaggtgcgggagcccaacaagaagaccaggatttggctcgggactttccccacagccgaaatggcagcgcgagctca
tgacgtggcggccatcaagctcagaggtcggtctgcttgcttgaactttgccgactccgcgtggcggctgcctgtcccgg
cttcagcaaacgccaaggatattcaaaccacagcttccgaggctgctgaggcgtttcggccacctgcggaggggtcggtt
gaggtttctggagcttcggcggtggccgcgtcagaaagcaagtcagcatcggaacaagtgttttatatggatgaggaggc
tgtttttgggatgccaggactcctcgcaaatatggccgaagggatgctgttgtctccacctctttacaccgaggatgacg
atgacgtggaattttatgctgacgtgccactatggagttattcgatttaa
back to top
>KC543501.1-CBF.m1723
atgaacaggttcttctctcatttttctgactccgtggaccagcccgagtcaagttcgttgtccgacgccacagtcacgac
tctaagggcttcttggtccgacgaggacgtcatattggcgtcgagccgaccaaagaagcgagctgggaggagggttttca
aggagaccaggcaccctgtttataggggcgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaag
aagacgaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggcggcattggc
gtttagagggaagcttgcctgcctcaacttccctgactccgcttggaggctgcccgtgccggcttccatggatgcaatgg
atattcggagagcagccgccgaggcagctgaggggtttaggccggtggagtttggtggagtgtccagcagcagcagtgat
gagaaggagagaatggtggtgcaggtggaagagaagaagaagaagaaggatagtgtgaaaatggaaaaaagtagaagctt
gagcttgtcctattgggatgaggaagaagtgtttgacatgccaaggttgcttgatgacatggctcaaggccttcttctta
ctccacctcaatgcttaggtggcgacatttgggatgacatgggaaccgatgctgatgtcaaattgtggagtttctccaat
taa
back to top
>KC543500.1-CBF.m1699
atggatttgatctacagccaggtctctgatttggcttctctggaaaacccggatacgtcgtcgttttggaacgccagcgt
cacggcccggcgagcttcactttcagttgaggaggtcatactggcgtccagctgcccgaaaaggcgggcggggaggaggg
ttttcaaggagaccaggcacccggtttataggggtgtgaggaggaggaacaacgacaagtgggtgtgtgagctgagagac
cccaacaacaagaaggccaggatatggctcgggacttatccgaaggctgagatggcggctcgtgcccatgacgtcgctgc
attggcgtttagggggaagcttgcctgcctcaactttgctgactcggcttggcgactgcccgtgccggcctccaacgatg
ccgcggagattaggagggtggccaacgaggcggctgaagcgtttaggaaagcggaggatggtggtgttgatgagaaggag
agtaagggggtggtgaatgaggagaagggttgtgtagaaatggagggaagcagcaacttgttttatttggacgaggagga
aatatttgagatgccaaggttgcttgatgacatggctgaagggcttatgctttgtccacctcagtgcttagatggctaca
tggattggaatgacgtgggaactgatgatgatttgaaactgtggagttttactatttga
back to top
>KC543499.1-CBF.m1711
atggacttgtctcaactttccgacccggtcgaccagcccgagtcgagttctttgtccgacgccagcgtcacgactcaggg
accttcttggtccgacggggacgtcatattggcttcgagcctgccaaagaagcgagccgggaggagggttttcaaggaga
cgaggcaccctgtttataggggtgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaacaagaag
aagtccaggatatggctcgggacttatccgacggcggagatggctgctcgagcccatgacgtggcggcattggcgtttag
agggaagcttgcctgcatcaattttgctgactccgcgtggaggctgcccttgccggcttccatggataccatggatattc
ggagagcggccgcggaggcagctgagaggtttaggccggcggagtttggtggaatgtgcagcggcagcagtgatgagaag
gagagaatggtggtgcaggtggaagaggaggacaagaagggtagtgtgaacttggaaagaagcttgagcttgtcctgttg
ggatgaggaggaagcgtttgacatgcccaggttgcttcacgacatggctgaagggcttcttctttctccaccgcaaccct
taggcagcgacatgaatttggatgacatgggtaccgatgctgatatcaaattgtggagtttctccatttaa
back to top
>KC543498.1-CBF.m1693
atggacatgttctccgctcagctttctgactcccccgaccagcctgagtcgagttctttctccgacgccagcgtcaccac
cctgccggcatcttcctccgacgaaaacgtcatattggcgtcgagccggccgaagaagcgcgctgggaggagggttttca
aggagacgaggcacccggtttacaggggcgtgaggagaaggaacaacaacaagtgggtatgtgagttgagagaacccaac
aacaagaagtcaaggatttggcttggaacgtatccgacggctgagatggctgctcgtgcccatgacgtggcggcattggc
gttcagagggaagcttgcctgcataaactttgctgactccgcatggcggctgcccttgccggcttccatggacaccatgg
atattcgaagggcagccgctgaggccgccgaagggttcaggcctgcggagttcggtggattatccagcggcagcagtgat
gagaaggagatgaatttaagcgtggatatggaaaaaaacagcagcttgtgcttgttttatttggatgaggaggaaatgtt
tgatatgccaaggttgattgataacatggctcaagggcttcttctttctccacctcaatgctcagctggctacttgaatt
gggatgacgtggaaactgaagctgatgccaaattatggagtttctctatctga
back to top
>JX464668.1-CBF.m1720
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcccaggtcgagttcgtcatccgacgcaagcgt
gagcaccttacgcacttcggacgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggaaggttttcaaagaga
cgaggcacccggtttataggggtgtgaggaggagagacaacaacaagtgggtgtgtgagttgagacagcccaacaagaag
aagtccgggatttggctcgggacctatcctacggctgagatggctgctcgtgcccatgacgtggcggcattggcttttaa
agggaagcttgcctgcctcaactttgctgactcgggttggcggctgccggtcgcggcatccatggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggtggggtttccagcggcagcagtgatgagaag
gagagaatggttgtggtggaagagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagcagattaaactt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgacaacatggctgaagggcttcttctttctccac
cccaatgcttagctggctatttgaattgggatgacatggaaactgaagctgattccaagttgtggagtttctctatctga
back to top
>HM992943.1-CBF.m1720
atggtcatggacatgatcttcgctcaggttgctgactcggccgaccagcccaggtcgagttcgtcatccgacgcaagcgt
gagcaccttacgcacttcggacgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggaaggttttcaaagaga
cgaggcacccggtttataggggtgtgaggaggagagacaacaacaagtgggtgtgtgagttgagacagcccaacaagaag
aagtccgggatttggctcgggacctatcctacggctgagatggctgctcgtgcccatgacgtggcggcattggcttttaa
agggaagcttgcctgcctcaactttgctgactcgggttggcggctgccggtcgcggcatccttggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggtggggtttccagcggcagcagtgatgagaag
gagagaatggttgtggtggaagagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagcagattaaactt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgacaacatggctgaagggcttcttctttctccac
cccaatgcttagctggctatttgaattgggatgacatggaaactgaagctgattccaagttgtggagtttctctatctga
back to top
>HM228387.1-CBF.m1693
atggacatgttctccgctcagctttctgactcccccgaccagcctgagtcgagttctttctccgacgccagcgtcaccac
cctgccggcatcttcctccgacgaaaacgtcatattggcgtcgagccggccgaagaagcgcgctgggaggagggttttca
aggagacgaggcacccggtttacaggggcgtgaggagaaggaacaacaacaagtgggtatgtgagttgagagaacccaac
aacaagaagtcaaggatttggcttggaacgtatccgacggctgagatggctgctcgtgcccatgacgtggcggcattggc
gttcagagggaagcttgcctgcataaactttgctgactccgcatggcggctgcccttgccggcttccatggacaccatgg
atattcgaagggcagccgctgaggccgccgaagggttcaggcctgcggagttcggtggattatccagcggcagcagtgat
gagaaggagatgaatttaagcgtggatatggaaaaaaacagcagcttgtgcttgttttatttggatgaggaggaaatgtt
tgatatgccaaggttgattgataacatggctcaagggcttcttctttctccacctcaatgctcagctggctacttgaatt
gggatgacgtggaaactgaagctgatgccaaattatggagtttctctatctga
back to top