CDPK, CDPK (gene) Malus x domestica

Gene Overview
Name CDPK
Gene Symbol CDPK
Type gene
Organism Malus x domestica
Synonym CDPK
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
calcium-dependent protein kinaseCDPKMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CDPKDQ069908.1-CDPK.m1Malus x domesticamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ069908.1-CDPK.m1 Chr07:5929849..5931789
chr7:5526353..5528294
chr7:5526418..5528359
chr7:6092240..6094181
DQ069908.1

Sequence(s):
>DQ069908.1-CDPK.m1390
ttgccattcattgggagttatgcatcgagaccttaaaccagagaactttctctttgtcagtcaggatgaggatgcacttc
tcaaaactattgattttggattatctattttcttgaagccaggagtaaaatatagtgatgtggttggaagcccatattat
gttgcacctgaagtgttacgcaagcgttatggtccagaagcagatgtctggagtgcaggggtgatcgtttacattctgtt
aagtggggtaccgccattttgggctgaaaacgagcaagcaatatttgaccaggtcctgcatggtgaactagatttcgaat
cagacccttggcctagtatttctgatggtgccaaagatttagtgaggagaatgcttgtccgagaccctaa
back to top