CDPK, CDPK (gene) Malus hupehensis

Gene Overview
Name CDPK
Gene Symbol CDPK
Type gene
Organism Malus hupehensis
Synonym calcium-dependent calmodulin-independent protein kinase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CDPKEF519915.1-CDPK.m1Malus hupehensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
calcium-dependent protein kinaseCDPKMalus hupehensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly EF519915.1-CDPK.m1 Chr02:30964903..30970801
chr2:29570513..29576411
EF519915.1

Sequence(s):
>EF519915.1-CDPK.m11701
atgggtaatacttgtgttggacctagcatttccaagaatggtttcttccaatcagtttcagctgtaatgtggccaaaccg
gtcgcctgatgactcagttcacacaaacggagaagctgtcgctgagacatcatcacctaaggaacctgagtcacctatgc
cagtactagacaaaccaccagagcaagtgacaataccaaatccagaaaccgagccaaaacaatccgcaaaacccaagaag
ctaccacagatgaagagggtccctagtgcaggactcgctggttcggtgttgcaaacgaaaactggaaagttaaaggagtt
ttacagtttggggagaaaactaggacaagggcagtttggaattacgtttctgtgtgtggagaaggcgacagggaaagagt
atgcgtgcaaatcgattgcaaaaaggaagttaataactgatgaggatgtggaggatgtgaggagggaaattcagatcatg
caccatttggcagggcacccaaatgttatatctattaagggagcttatgaggatgctatagcagttcatgttgtaatgga
attatgtgcaggaggtgagctgtttgataggattatccagcgtgggcattatacagaaagaaaggcagctgagctaacta
ggactatagttggagttgtcgaagcttgccattcattgggagttatgcatcgagaccttaagccggagaattttcttttt
gtcagtcaggatgaggatgcactactgaaaactattgattttggattatctattttcttgaagccaggagtaaaatttac
tgatgtggttggaagtccatattatgttgcacctgaagtgttacgcaagcgttatggtccagaagcagatgtctggagtg
caggagtaatcctttacattctgttaagtggggtacctccattttgggctgaaggtgagcacggaatatttgaacaggtc
ctgcatggtgacttagattttgaatcagacccttggcctagtatttctgatggtgccaaagatttagtgaggagaatgct
tgtccgagaccctaaaaggcggctgacagcacatgaagttttgtgccacccctgggtgcaagttgatggtgtggctcccg
ataaggctcttgattctgcagttctaagtcgcttaaaacaattttcagctatgaacaagctcaagaaaatggctctcaga
gtaattgcagagaggttgtctgaagaagaaatagctggcctgaaagaaatgttcaagatgatagacactgacaacagtgg
tcaaatcacttttgacgaactcaaggccggattgaaaagatttggagcaactctggaggagtctgaaatttatgatctaa
tgcaagcagcagatgtcgataacagtggaaccattgattatggggagttcgtagctgcaacattgcatctgaacaaaatt
gagagagaagatcatctattttcagctttctcctactttgataaggatggaagtggctatattacttcagatgagcttca
agtagcttgtgaggagtttggcatagaggatgttcggctcgaagagatgataagagaagttgatcaggacaatgatggac
gcatagattacaacgagtttgtagccatgatgcagaaaggaaattttgttggcccgggtaagaagggattgcaaagtagc
ttcagcattgcctttagataa
back to top