CMO, CMO (gene) Pyrus betulifolia

Gene Overview
Name CMO
Gene Symbol CMO
Type gene
Organism Pyrus betulifolia
Synonym choline monooxygenase
PbCMO
Description NA
Comment PbCMO
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CMOJF968604.1-CMO.m1Pyrus betulifoliamRNA
CMOJF968603.1-CMO.m1Pyrus betulifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
choline monooxygenaseCMOPyrus betulifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JF968604.1-CMO.m1 scaffold00052:56000..58941
JF968604.1
mRNA parsed from NCBI nr database JF968603.1-CMO.m1 scaffold00052:56000..58941
JF968603.1

Sequence(s):
>JF968604.1-CMO.m11227
atggcgatgactgtggcaactttccaacccaaaacacttcgacccaaaagcccttaccttcttcccaatctacccagaaa
agtttgcaacttcaaggccttctccctccacaatccccagctcccatcactcgtgggtcagttcgaacccaccatcccaa
tagagagagcagggactcctcccagctcatggtacaccgatccatccttttactctctcgaactcgacacccttttctac
cgtggatggcaggccgtaggatatacagaacagattaggaatgcaggggagtttttcactggcagattgggaaacgtaga
gtttgtggtatgccaagatggtgatggaaagcttcaagcttttcacaatgtctgtcgacatcacgcgatgctccttgcgt
atggaagtggccgcaagtcctgctttgtctgcccttatcatgtcaggcagggatggacgtatgggtttgatggtgcactt
ctcaaggcaactaggataactggaatacagaatttcaatgaacacgagtttggacttgtaccactaaaagtagcaacttg
gggaccgtttattcttctcaatatggaacagaatgttgacagtgatccaggcagtgtgcaaaatgaatggcttggcagct
ccgcagaagtactgagtaacaacgggattgatacttcattaagttttgtttgccgacgtgattatgtgattgaatgtaac
tggaaggtcttttgtgacaactacttagatgggggataccacgtgccttatgcacataaaggccttgcatctggtcttaa
tcttgacggttactctaccacagtatatgaaaaggtcagcattcaaaagtgtgaaagcggctcgacagaaagaaaaaatg
attttgatcggcttgggtcaaaagcgctgtatgctttcgtgtatccaaatttcatgattaataggtatggaccttggatg
gataccaatctagtattgccgctgggacaaaggaaatgtcaagtgagatttgattactttattgaagcttctcttaagga
tgacacagattttatagagagaagtttgaaagacagtgaaagagtacagatggaagatgtcatgttatgtgaaggcgttc
aaagaggtttggaatcgcccgcgtacaatatcggtcgatacgccccgactgttgagaatgccatgcaccatttccattgc
ctgcttcacaagggcctaacagaatga
back to top
>JF968603.1-CMO.m11227
atggcgatgactgtggcaactttccaacccaaaacacttcgacccaaaagcccttaccttcttcccaatctacccagaaa
agtttgcaacttcaaggccttctccctccacaatccccagctcccatcactcgtgggtcagttcgaacccaccatcccaa
tagagagagcagggactcctcccagctcatggtacaccgatccatccttttactctctcgaactcgacacccttttctac
cgtggatggcaggccgtaggatatacagaacagattaggaatgcaggggagtttttcactggcagattgggaaacgtaga
gtttgtggtatgccaagatggtgatggaaagcttcaagcttttcacaatgtctgtcgacatcacgcgatgctccttgcgt
atggaagtggccgcaagtcctgctttgtctgcccttatcatgtcaggcagggatggacgtatgggtttgatggtgcactt
ctcaaggcaactaggataactggaatacagaatttcaatgaacacgagtttggacttgtaccactaaaagtagcaacttg
gggaccgtttattcttctcaatatggaacagaatgttgacagtgatccaggcagtgtgcaaaatgaatggcttggcagct
ccgcagaagtactgagtaacaacgggattgatacttcattaagttttgtttgccgacgtgattatgtgattgaatgtaac
tggaaggtcttttgtgacaactacttagatgggggataccacgtgccttatgcacataaaggccttgcatctggtcttaa
tcttgacggttactctaccacagtatatgaaaaggtcagcattcaaaagtgtgaaagcggctcgacagaaagaaaaaatg
attttgatcggcttgggtcaaaagcgctgtatgctttcgtgtatccaaatttcatgattaataggtatggaccttggatg
gataccaatctagtattgccgctgggacaaaggaaatgtcaagtgagatttgattactttattgaagcttctcttaagga
tgacacagattttatagagagaagtttgaaagacagtgaaagagtacagatggaagatgtcatgttatgtgaaggcgttc
aaagaggtttggaatcgcccgcgtacaatatcggtcgatacgccccgactgttgagaatgccatgcaccatttccattgc
ctgcttcacaagggcctaacagaatga
back to top