CNR12, CNR12 (gene) Prunus avium

Gene Overview
Name CNR12
Gene Symbol CNR12
Type gene
Organism Prunus avium
Synonym cell number regulator 12
Description NA
Comment PavCNR12
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CNR12KC139088.1-CNR12Prunus aviumgene
CNR12KC139087.1-CNR12Prunus aviumgene
CNR12KC139086.1-CNR12Prunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CNR12KC139088.1-CNR12.m1Prunus aviummRNA
CNR12KC139087.1-CNR12.m1Prunus aviummRNA
CNR12KC139086.1-CNR12.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cell number regulatorCNRPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC139088.1-CNR12 N/A KC139088.1
gene parsed from NCBI nr database KC139087.1-CNR12 N/A KC139087.1
gene parsed from NCBI nr database KC139086.1-CNR12 N/A KC139086.1
mRNA parsed from NCBI nr database KC139088.1-CNR12.m1 scaffold_2:15647988..15650767
KC139088.1
mRNA parsed from NCBI nr database KC139087.1-CNR12.m1 scaffold_2:15647988..15650767
KC139087.1
mRNA parsed from NCBI nr database KC139086.1-CNR12.m1 scaffold_2:15647988..15650767
KC139086.1

Sequence(s):
>KC139088.1-CNR122767
atggctgatggaaatccccaatcgaggtacgtgaagttgacgagggaacaagaagcgccaacggaagatatcacccctgg
agagctcaaccaacccattcaaattcctcaggtccttctttcacttcctgggcttcgaattttttttgcagaaaatcgca
aatttgggttcatatctgagaaaaatgataatgttggatgttggttttctgttgttttttgtgttttcttctatcttgtt
gcaaattagcttctggtttgcttataattgatattcttagaaacctctcctctgtttttaaattataagtgcaatgctaa
tgatatttctgacattgaggtgacatgttttagtgtgcatttatctatgtgatgtacctcaatctaatgttgaaatattg
tccttgttatgtttttttgttggtgttgatgattatgtttagtactggacagttaattgttgataagtgtgcggaatgtg
ggcaacccctgcctgaaagataccaacccccagctgatgaagaatggacaactgggatatttggctgtgctgaagatcct
gggagttgtaagcgttcatctgctgtatcacttttcgttttcttttttctcgggatgggaggcggtttgaaagcataatt
ttctacttttgttgattaatcaggcgaggaaaaacagggttacatgtggcccacttatgatgattaataaggcaaagaaa
aacaatgttaaaatgtgacctaatgatttggaagttagacctttagattgtccaagttaagcaaaattgtttttttacgc
aaccagttctcacctcagcaggtcagaaggctttgtgtatccaaataggaatagcattttggaaatttatgttactctcc
tagtttttacatattgtgttccttgctgagatcataatgtgcctagatttgtttggattttctgaagaaaaagagagaag
atttttagattttagagtattagttgagtgagataaattagatgtcactaccctgatggaatatattttatcacactttc
ctgatcattcaaaattccttgaatttattgtgtttatgttgcaggctggactggacttttctgtccttgtgtgctgtttg
ggcgtaatgttgaaacaatacgagaagatattccctggaacaatgcctgtgtttgccatgccatgtgtgttgaaggagga
attgcagttgcagcagcaacaggattctttcatggtcttgatcctaagacttcagttctcatctgtgagacattgctatt
tgcctggtggatgtgtgcaatctacacaggtctgtttaggcagtcattgcaaaagaagtatcatctcaaggtgaatttca
gttcctatatttcttgaaatgcaaaataaatcagatcatctggaagaataggatgtgaataaatttctgaaatgtaaaag
gcccgtgtacattcactttagataattttgtgttttctccaatttatttttgcatttttggtaagttattttgttaaatt
tttttccacatgattttgctttgtacgcaaatggcttttggtgataggccctacttttaataaggtgaagtttttcttgt
ctcacatataatatatagcttctgatgtgaattttatgtcatactatgaaatgttgattcatgtgtttgactttcccgtt
cgagtgtgatgttcttttgttgtgtgtgtgtaaaccagatggtttgtttgctaaattgcctttgcactatcctcagctgg
tcagcaaatcaattatctacattgtctgctataaagagcttttagatacaagattgttttttaatcagtgtttacttcga
taattttatgtgttagtagcactgatgcttcagaaagagcagacttcatttattttcatttatatgcttgaaattttatc
tttcttcaatacttccttctaaacttaagtaggataaaaataaataaaaattcatttgttaatcagtttcccagatagaa
tgtgaaatggatgaatttgagcctttaagtgtatttgtttacttttctgctatcaatatctagatttaagtctctctgat
gtactagcattgcatgctgaaaagatgtatctaaatcaaagacctaagtggtcatagaaagaagccatcaacacattagt
tatcaaatggtttagatactccaatttttagagctaatacggggcccttgagacatgatatcacgggttcctgttttcaa
aacctcaagatttacagctttaaatttttggtggaaactcagaatattttgtttatgaaagagtagcttgaggtttgtaa
caattgctttcagaaaaaagtaatttagtgttagcttttattatggaaagaaagccctgaaatctgtttcccttcctgaa
aaagctaatgaactcttttaggattatttcatttgaacattaacacctatagtggtgatgggttctgacttagtgtgcta
cttttctgcaggattcaccctgtgatccatgcctggtgcactgctgcatgcactggtgtgctttgtgtcaagagcacagg
gagatgaggaaccacctatctgataatacttccaatacgatgacccttgttgcccctccaccagttcaagagatgaactc
tggagagaacaaggatgctgcttcgtcttcggagtcttcaggtcatgaacacaatgatgctgcttcgtctgcagagtctt
ctgatcataaaaacaccaatatggagttggccctgcagcctgtgtag
back to top
>KC139087.1-CNR122767
atggctgatggaaatccccaatcgaggtacgtgaagttgacgagggaacaagaagcgccaacggaagatatcacccctgg
agagctcaaccaacccattcaaattcctcaggtccttctttcacttcctgggcttcgaattttttttgcagaaaatcgca
aatttgggttcatatctgagaaaaatgataatgttggatgttggttttctgttgttttttgtgttttcttctatcttgtt
gcaaattagcttctggtttgcttataattgatattcttagaaacctctcctctgtttttaaattataagtgcaatgctaa
tgatatttctgacattgaggtgacatgttttagtgtgcatttatctatgtgatgtacctcaatctaatgttgaaatattg
tccttgttatgtttttttgttggtgttgatgattatgtttagtactggacagttaattgttgataagtgtgcggaatgtg
ggcaacccctgcctgaaagataccaacccccagctgatgaagaatggacaactgggatatttggctgtgctgaagatcct
gggagttgtaagcgttcatctgctgtatcacttttcgttttcttttttctcgggatgggaggcggtttgaaagcataatt
ttctacttttgttgattaatcaggcgaggaaaaacagggttacatgtggcccacttatgatgattaataaggcaaagaaa
aacaatgttaaaatgtgacctaatgatttggaagttagacctttagattgtccaagttaagcaaaattgtttttttacgc
aaccagttctcacctcagcaggtcagaaggctttgtgtatccaaataggaatagcattttggaaatttatgttactctcc
tagcttttacatattgtgttccttgctgagatcataatgtgcctagatttgtttggattttctgaagaaaaagagagaag
atttttagattttagagtattagttgagtgagataaattagatgtcactaccctgatggaatatattttatcacactttc
ctgatcattcaaaattccttgaatttattgtgtttatgttgcaggctggactggacttttctgtccttgtgtgctgtttg
ggcgtaatgttgaaacaatacgagaagatattccctggaacaatgcctgtgtttgccatgccatgtgtgttgaaggagga
attgcagttgcagcagcaacaggattctttcatggtcttgatcctaagacttcagttctcatctgtgagacattgctatt
tgcctggtggatgtgtgcaatctacacaggtctgtttaggcagtcattgcaaaagaagtatcatctcaaggtgaatttca
gttcctatatttcttgaaatgcaaaataaatcagatcatctggaagaataggatgtgaataaatttctgaaatgtaaaag
gcccgtgtacattcactttagataattttgtgttttctccaatttatttttgcatttttggtaagttattttgttaaatt
tttttccacatgattttgctttgtacgcaaatggcttttggtgataggccctacttttaataaggtgaagtttttcttgt
ctcacatataatatatagcttctgatgtgaattttatgtcatactatgaaatgttgattcatgtgtttgactttcccgtt
cgagtgtgatgttcttttgttgtgtgtgtgtaaaccagatggtttgtttgctaaattgcctttgcactatcctcagctgg
tcagcaaatcaattatctacattgtctgctataaagagcttttagatacaagattgttttttaatcagtgtttacttcga
taattttatgtgttagtagcactgatgcttcagaaagagcagacttcatttattttcatttatatgcttgaaattttatc
tttcttcaatacttccttctaaacttaagtaggataaaaataaataaaaattcatttgttaatcagtttcccagatagaa
tgtgaaatggatgaatttgagcctttaagtgtatttgtttacttttctgctatcaatatctagatttaagtctctctgat
gtactagcattgcatgctgaaaagatgtatctaaatcaaagacctaagtggtcatagaaagaagccatcaacacattagt
tatcaaatggtttagatactccaatttttagagctaatacggggcccttgagacatgatatcacgggttcctgttttcaa
aacctcaagatttacagctttaaatttttggtggaaactcagaatattttgtttatgaaagagtagcttgaggtttgtaa
caattgctttcagaaaaaagtaatttagtgttagcttttattatggaaagaaagccctgaaatctgtttcccttcctgaa
aaagctaatgaactcttttaggattatttcatttgaacattaacacctatagtggtgatgggttctgacttagtgtgcta
cttttctgcaggattcaccctgtgatccatgcctggtgcactgctgcatgcactggtgtgctttgtgtcaagagcacagg
gagatgaggaaccacctatctgataatacttccaatacgatgacccttgttgcccctccaccagttcaagagatgaactc
tggagagaacaaggatgctgcttcgtcttcggagtcttcaggtcatgaacacaatgatgctgcttcgtctgcagagtctt
ctgatcataaaaacaccaatatggagttggccctgcagcctgtgtag
back to top
>KC139086.1-CNR122767
atggctgatggaaatccccaatcgaggtacgtgaagttgacgagggaacaagaagcgccaacggaagatatcacccctgg
agagctcaaccaacccattcaaattcctcaggtccttctttcacttcctgggcttcgaattttttttgcagaaaatcgca
aatttgggttcatatctgagaaaaatgataatgttggatgttggttttctgttgttttttgtgttttcttctatcttgtt
gcaaattagcttctggtttgcttataattgatattcttagaaacctctcctctgtttttaaattataagtgcaatgctaa
tgatatttctgacattgaggtgacatgttttagtgtgcatttatctatgtgatgtacctcaatctaatgttgaaatattg
tccttgttatgtttttttgttggtgttgatgattatgtttagtactggacagttaattgttgataagtgtgcggaatgtg
ggcaacccctgcctgaaagataccaacccccagctgatgaagaatggacaactgggatatttggctgtgctgaagatcct
gggagttgtaagcgttcatctgctgtatcacttttcgttttcttttttctcgggatgggaggcggtttgaaagcataatt
ttctacttttgttgattaatcaggcgaggaaaaacagggttacatgtggcccacttatgatgattaataaggcaaagaaa
aacaatgttaaaatgtgacctaatgatttggaagttagacctttagattgtccaagttaagcaaaattgtttttttacgc
aaccagttctcacctcagcaggtcagaaggctttgtgtatccaaataggaatagcattttggaaatttatgttactctcc
tagtttttacatattgtgttccttgctgagatcataatgtgcctagatttgtttggattttctgaagaaaaagagagaag
atttttagattttagagtattagttgagtgagataaattagatgtcactaccctgatggaatatattttatcacactttc
ctgatcattcaaaattccttgaatttattgtgtttatgttgcaggctggactggacttttctgtccttgtgtgctgtttg
ggcgtaatgttgaaacaatacgagaagatattccctggaacaatgcctgtgtttgccatgccatgtgtgttgaaggagga
attgcagttgcagcagcaacaggattctttcatggtcttgatcctaagacttcagttctcatctgtgagacattgctatt
tgcctggtggatgtgtgcaatctacacaggtctgtttaggcagtcattgcaaaagaagtatcatctcaaggtgaatttca
gttcctatatttcttgaaatgcaaaataaatcagatcatctggaagaataggatgtgaataaatttctgaaatgtaaaag
gcccgtgtacattcactttagataattttgtgttttctccaatttatttttgcatttttggtaagttattttgttaaaaa
tttttccacatgattttgctttgtacgcaaatggcttttggtgataggccctacttttaataaggtgaagtttttcttgt
ctcacatataatatatagcttctgatgtgaattttatgtcatactatgaaatgttgattcatgtgtttgactttcccgtt
cgagtgtgatgttcttttgttgtgtgtgtgtaaaccagatggtttgtttgctaaattgcctttgcactatcctcagctgg
tcagcaaatcaattatctacattgtctgctataaagagcttttagatacaagattgttttttaatcagtgtttacttcga
taattttatgtgttagtagcactgatgcttcagaaagagcagacttcatttattttcatttatatgcttgaaattttatc
tttcttcaatacttccttctaaacttaagtaggataaaaataaataaaaattcatttgttaatcagtttcccagatagaa
tgtgaaatggatgaatttgagcctttaagtgtatttgtttacttttctgctatcaatatctagatttaagtctctctgat
gtactagcattgcatgctgaaaagatgtatctaaatcaaagacctaagtggtcatagaaagaagccatcaacacattagt
tatcaaatggtttagatactccaatttttagagctaatacgggccccttgagacatgatatcacgggttcctgttttcaa
aacctcaagatttacagctttaaatttttggtggaaactcagaatattttgtttatgaaagagtagcttgaggtttgtaa
caattgctttcagaaaaaagtaatttagtgttagcttttattatggaaagaaagccctgaaatctgtttcccttcctgaa
aaagctaatgaactcttttaggattatttcatttgaacattaacacctatagtggtgatgggttctgacttagtgtgcta
cttttctgcaggattcaccctgtgatccatgcctggtgcactgctgcatgcactggtgtgctttgtgtcaagagcacagg
gagatgaggaaccacctatctgataatacttccaatacgatgacccttgttgcccctccaccagttcaagagatgaactc
tggagagaacaaggatgctgcttcgtcttcggagtcttcaggtcatgaacacaatgatgctgcttcgtctgcagagtctt
ctgatcataaaaacaccaatatggagttggccctgcagcctgtgtag
back to top
>KC139088.1-CNR12.m1768
atggctgatggaaatccccaatcgaggtacgtgaagttgacgagggaacaagaagcgccaacggaagatatcacccctgg
agagctcaaccaacccattcaaattcctcagttaattgttgataagtgtgcggaatgtgggcaacccctgcctgaaagat
accaacccccagctgatgaagaatggacaactgggatatttggctgtgctgaagatcctgggagttgctggactggactt
ttctgtccttgtgtgctgtttgggcgtaatgttgaaacaatacgagaagatattccctggaacaatgcctgtgtttgcca
tgccatgtgtgttgaaggaggaattgcagttgcagcagcaacaggattctttcatggtcttgatcctaagacttcagttc
tcatctgtgagacattgctatttgcctggtggatgtgtgcaatctacacaggtctgtttaggcagtcattgcaaaagaag
tatcatctcaaggattcaccctgtgatccatgcctggtgcactgctgcatgcactggtgtgctttgtgtcaagagcacag
ggagatgaggaaccacctatctgataatacttccaatacgatgacccttgttgcccctccaccagttcaagagatgaact
ctggagagaacaaggatgctgcttcgtcttcggagtcttcaggtcatgaacacaatgatgctgcttcgtctgcagagtct
tctgatcataaaaacaccaatatggagttggccctgcagcctgtgtag
back to top
>KC139087.1-CNR12.m1768
atggctgatggaaatccccaatcgaggtacgtgaagttgacgagggaacaagaagcgccaacggaagatatcacccctgg
agagctcaaccaacccattcaaattcctcagttaattgttgataagtgtgcggaatgtgggcaacccctgcctgaaagat
accaacccccagctgatgaagaatggacaactgggatatttggctgtgctgaagatcctgggagttgctggactggactt
ttctgtccttgtgtgctgtttgggcgtaatgttgaaacaatacgagaagatattccctggaacaatgcctgtgtttgcca
tgccatgtgtgttgaaggaggaattgcagttgcagcagcaacaggattctttcatggtcttgatcctaagacttcagttc
tcatctgtgagacattgctatttgcctggtggatgtgtgcaatctacacaggtctgtttaggcagtcattgcaaaagaag
tatcatctcaaggattcaccctgtgatccatgcctggtgcactgctgcatgcactggtgtgctttgtgtcaagagcacag
ggagatgaggaaccacctatctgataatacttccaatacgatgacccttgttgcccctccaccagttcaagagatgaact
ctggagagaacaaggatgctgcttcgtcttcggagtcttcaggtcatgaacacaatgatgctgcttcgtctgcagagtct
tctgatcataaaaacaccaatatggagttggccctgcagcctgtgtag
back to top
>KC139086.1-CNR12.m1768
atggctgatggaaatccccaatcgaggtacgtgaagttgacgagggaacaagaagcgccaacggaagatatcacccctgg
agagctcaaccaacccattcaaattcctcagttaattgttgataagtgtgcggaatgtgggcaacccctgcctgaaagat
accaacccccagctgatgaagaatggacaactgggatatttggctgtgctgaagatcctgggagttgctggactggactt
ttctgtccttgtgtgctgtttgggcgtaatgttgaaacaatacgagaagatattccctggaacaatgcctgtgtttgcca
tgccatgtgtgttgaaggaggaattgcagttgcagcagcaacaggattctttcatggtcttgatcctaagacttcagttc
tcatctgtgagacattgctatttgcctggtggatgtgtgcaatctacacaggtctgtttaggcagtcattgcaaaagaag
tatcatctcaaggattcaccctgtgatccatgcctggtgcactgctgcatgcactggtgtgctttgtgtcaagagcacag
ggagatgaggaaccacctatctgataatacttccaatacgatgacccttgttgcccctccaccagttcaagagatgaact
ctggagagaacaaggatgctgcttcgtcttcggagtcttcaggtcatgaacacaatgatgctgcttcgtctgcagagtct
tctgatcataaaaacaccaatatggagttggccctgcagcctgtgtag
back to top