CNR20, CNR20 (gene) Prunus avium

Gene Overview
Name CNR20
Gene Symbol CNR20
Type gene
Organism Prunus avium
Synonym cell number regulator 20
Description NA
Comment PavCNR20
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CNR20KC154001.1-CNR20Prunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CNR20KC154001.1-CNR20.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cell number regulatorCNRPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC154001.1-CNR20 N/A KC154001.1
mRNA parsed from NCBI nr database KC154001.1-CNR20.m1 N/A KC154001.1

Sequence(s):
>KC154001.1-CNR201892
ttttttttcccacaggaaaatatgacaattatgcacttgcatgaaatagttggataaatagttggttaatacttgaaaat
caggtcttctggattataagatcatattttttttatagatatgttttgtcagtgttctttcctacatgttatcgacattt
ttcatactaacgttgatgtgatctggttaggccttcttggaagtgtggctccttgtgtgctgtacggaagcaatgtcgag
agacttggatctactcctgggacgtttgcaaatcactgtttgtcttactctggtctatatctgattggaaataccttttt
tggttggaactgccttgcaccatggttttcatatcctagccgtactgctatccgccgcaagttcaacctagaggcaagtt
atatttttcctcccaaaatatgtttacggttttgattcagataaacttagcctgttttcgtattgttttgatttatagat
taagttttggttatgtttgtatgtctgtaatattttgcaatgcatatgattttgattcagttacactttatatggtccct
ttctttagcatggctttgcaatgaatctaatcatcacacacattactttagttgtccgtctcaaagccgtacatggtgaa
tatttggcattgttgtgttagccttacatagtgaatacttggcattgttttatatattcttacaagagaattgaggagag
gttttgaatgtgtggttttatggtttttggtgatgagcagggtagctgtgaggcgcttcataggtcatgcggatgctgtg
gcagctttgtggaagatgaggtacaacaagaacagtgtgagactgcctgtgattttgcgactcatgttttctgccatcca
tgcgccctttgccaggaaggtcgtgagatccgtcgcaggctgcttcatcctggtttcaatgctcaaccaattctggttat
gattcctcccggggagcaggccatgggccgtggagcttgagagcgtacttcgtgggcacgagatgcttgtactttgtgta
tacatacttaagtgtgttttgatcaagagctgtgttaaaactgcattgagttatctatccgaaccgcatggtttacttgg
ttttttgcaatcaagtataaataagataagatgaaagtatatagacttgtgtgtatgtaatacttgatatctatgtacct
gtttgttcattgaatattgactgcgttagttacagattaaaactatttttctatttatctataaatataaatataaattg
tggaagtttgtaatttgataagacaaatgtcattttaaacgaacttagtaatagtattagttagtgtaatgatggagttt
ttctattcgaacccatcatccaactttgccctgagacatccatctcatccaactttggcctcctcaccttctctttatat
ataggcatcgcttaccttaccactgtcgtatcattaatctatggtggcggcttctgttggtttcggtgaattggaaaccg
catagcaaatggcaaatggttcaagatgtaccatacatatgatatcaaattatgatctatgtaaaacaacttcaagaaaa
tgacataatcattcagagaatcaaagacgatgggtttcaccctgatgtggccacttatggcagccttgccaatggaattg
cattggctggaaaaccaggagaggcactcttgctttggatttggaatgaagtcaaggagagatgtagggtgaaaatggga
ggggaatcttccgatccgccaatgccgagacccgatgaaggttaggaaatataaatgtgacaacaaatatttagtatcat
catgcaatgaaagttaggaaatcggcccttatcaatacaaaatgtgagtagt
back to top
>KC154001.1-CNR20.m1443
gccttcttggaagtgtggctccttgtgtgctgtacggaagcaatgtcgagagacttggatctactcctgggacgtttgca
aatcactgtttgtcttactctggtctatatctgattggaaataccttttttggttggaactgccttgcaccatggttttc
atatcctagccgtactgctatccgccgcaagttcaacctagagggtagctgtgaggcgcttcataggtcatgcggatgct
gtggcagctttgtggaagatgaggtacaacaagaacagtgtgagactgcctgtgattttgcgactcatgttttctgccat
ccatgcgccctttgccaggaaggtcgtgagatccgtcgcaggctgcttcatcctggtttcaatgctcaaccaattctggt
tatgattcctcccggggagcaggccatgggccgtggagcttga
back to top