COI1, COI1 (gene) Pyrus pyrifolia

Gene Overview
Name COI1
Gene Symbol COI1
Type gene
Organism Pyrus pyrifolia
Synonym coronatine insensitive 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COI1KF434755.1-COI1.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
coronatine insensitiveCOIPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KF434755.1-COI1.m1 scaffold00175:161976..162507
KF434755.1

Sequence(s):
>KF434755.1-COI1.m1531
gagacaataacagatttgccacttgacaatggggttcgagctcttttgaggggatgccagaagcttcgtaggtttgctct
gtatctccgtcgtgggggcttgactgatctgggactgagttatatcggccagtacagtcagaatgtgagatggatgcttc
tgggttatgttggggaatctgatgcagggcttttggctttctcaaagggttgccctagcctgcaaaaattggaaatgagg
ggttgctgcttcagcgagcgtgcactcgctgatgctgtaatgcaactgacttcccttaggtacttgtgggtgcaggggta
cagaggatctggaactggtcgcgaccttttggcaatggctcgcccattttggaatatcgagttgattcctccgagacgag
ttgatgttcctgatcagcagggagtcgagcatccagcccatatacttgcatactactcacttgctggaccgagaacagat
tttccagacagtgttattcccgttgatccggcatccttgctctccttctag
back to top