COX1, COX1 (gene) Malus x domestica

Gene Overview
Name COX1
Gene Symbol COX1
Type gene
Organism Malus x domestica
Synonym cytochrome c oxidase subunit 1
Description NA
Comment Protein sequence is in conflict with the conceptual translation
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1AB588946.1-COX1Malus x domesticagene
COX1AB588945.1-COX1Malus x domesticagene
COX1AB588944.1-COX1Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1AB588946.1-COX1.m1Malus x domesticamRNA
COX1AB588945.1-COX1.m1Malus x domesticamRNA
COX1AB588944.1-COX1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome c oxidaseCOXMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB588946.1-COX1 N/A AB588946.1
gene parsed from NCBI nr database AB588945.1-COX1 N/A AB588945.1
gene parsed from NCBI nr database AB588944.1-COX1 N/A AB588944.1
mRNA parsed from NCBI nr database AB588946.1-COX1.m1 N/A AB588946.1
mRNA parsed from NCBI nr database AB588945.1-COX1.m1 N/A AB588945.1
mRNA parsed from NCBI nr database AB588944.1-COX1.m1 N/A AB588944.1

Sequence(s):
>AB588946.1-COX1247
tacgacacgatggctgttctccactaaccacaagtatacagggactctatatttcatcttcggtgctattgctggagtga
tgggcacatgcttctcagtactgattcgtatggaattagcacgacccggcgatcaaattcttggtggtaatcatcaactt
tataatgttttaataacggctcacgcttttttaatgatcttttttatggttatgccggcgatgataggcggatatggtaa
ttggtct
back to top
>AB588945.1-COX1246
acgacacgatggctgttctccactaaccacaagtatacagggactctatatttcatcttcggtgctattgctggagtgat
gggcacatgcttctcagtactgattcgtatggaattagcacgacccggcgatcaaattcttggtggtaatcatcaacttt
ataatgttttaataacggctcacgcttttttaatgatcttttttatggttatgccggcgatgataggcggatatggtaat
tggtct
back to top
>AB588944.1-COX11566
acgacacgatggctgttctccactaaccacaaggatatagggactctatatttcatcttcggtgctattgctggagtgat
gggcacatgcttctcagtactgattcgtatggaattagcacgacccggcgatcaaattcttggtggtaatcatcaacttt
ataatgttttaataacggctcacgcttttttaatgatcttttttatggttatgccggcgatgataggcggatctggtaat
tggtctgttccgattctgataggtgcacctgacatggcatttccacgattaaataatatttcattctggttgttgccacc
tagtctcttgctcctattaagctcagccttagtagaagtgggtagcggcactgggtggacggtctatccgcccttaagtg
gtattaccagccattctggaggagctgttgatttagcaatttctagtcttcatctatctggtgtttcatccattttaggt
tctatcaattttataacaactatctccaacatgcgtggacctggaatgactatgcatagatcacccctatttgtgtggtc
cgttctagtgacagcattcctacttttattatcacttccggtactggcgggggcaattaccatgttattaaccgatcgaa
actttaatacaaccttttctgatcccgctggagggggagaccccatattataccagcatctctttcggttctttggtcat
ccagaagtgtatattcccattctgcctggatccggtatcataagtcatatcgtttcgactttttcgggaaaaccggtctt
cgggtatctaggcatggtttatgccatgatcagtacaggtgttcttggatttcttgtttgggctcatcatatgtttactg
tgggcttagacgttgatacccgtgcctactttaccgcagctaccatgatcatagccgtccccactggaataaaaatcttt
agttggatcgctaccatgtgggggggctcgatacaatacaaaacacccatgttatttgctgtagggttcatctttttgtt
caccataggaggactcactggaatagtcctggcaaattctgggctagacattgctctacatgatacttattatgtggttg
cacatttccattatgtactttctatgggagccgtttttgctttatttgcaggatttcactattgggtgggtaaaatcttt
ggtcggacataccctgaaactttagggcaaatacatttttggatcacttttttcggggttaatctgaccttctttccaat
gcatttcttaggcctttcgggtatgccacgtcgcattccagattatccggatgcttacgctgggtggaatgccattagca
gttttggctcttacatatccgtagttgggattcgtcgtttcttcgtggtcgtaacaatcacttcaagcagtggaaataac
aaaagatgcgctccaagtccttgggctgttgaacagaattcaaccacactggaatggatggtacaaagtcctccagcttt
tcatacttttggagaacttccagctatcaaggaaaccgtgaagtaa
back to top
>AB588946.1-COX1.m1247
tacgacacgatggctgttctccactaaccacaagtatacagggactctatatttcatcttcggtgctattgctggagtga
tgggcacatgcttctcagtactgattcgtatggaattagcacgacccggcgatcaaattcttggtggtaatcatcaactt
tataatgttttaataacggctcacgcttttttaatgatcttttttatggttatgccggcgatgataggcggatatggtaa
ttggtct
back to top
>AB588945.1-COX1.m1246
acgacacgatggctgttctccactaaccacaagtatacagggactctatatttcatcttcggtgctattgctggagtgat
gggcacatgcttctcagtactgattcgtatggaattagcacgacccggcgatcaaattcttggtggtaatcatcaacttt
ataatgttttaataacggctcacgcttttttaatgatcttttttatggttatgccggcgatgataggcggatatggtaat
tggtct
back to top
>AB588944.1-COX1.m11566
acgacacgatggctgttctccactaaccacaaggatatagggactctatatttcatcttcggtgctattgctggagtgat
gggcacatgcttctcagtactgattcgtatggaattagcacgacccggcgatcaaattcttggtggtaatcatcaacttt
ataatgttttaataacggctcacgcttttttaatgatcttttttatggttatgccggcgatgataggcggatctggtaat
tggtctgttccgattctgataggtgcacctgacatggcatttccacgattaaataatatttcattctggttgttgccacc
tagtctcttgctcctattaagctcagccttagtagaagtgggtagcggcactgggtggacggtctatccgcccttaagtg
gtattaccagccattctggaggagctgttgatttagcaatttctagtcttcatctatctggtgtttcatccattttaggt
tctatcaattttataacaactatctccaacatgcgtggacctggaatgactatgcatagatcacccctatttgtgtggtc
cgttctagtgacagcattcctacttttattatcacttccggtactggcgggggcaattaccatgttattaaccgatcgaa
actttaatacaaccttttctgatcccgctggagggggagaccccatattataccagcatctctttcggttctttggtcat
ccagaagtgtatattcccattctgcctggatccggtatcataagtcatatcgtttcgactttttcgggaaaaccggtctt
cgggtatctaggcatggtttatgccatgatcagtacaggtgttcttggatttcttgtttgggctcatcatatgtttactg
tgggcttagacgttgatacccgtgcctactttaccgcagctaccatgatcatagccgtccccactggaataaaaatcttt
agttggatcgctaccatgtgggggggctcgatacaatacaaaacacccatgttatttgctgtagggttcatctttttgtt
caccataggaggactcactggaatagtcctggcaaattctgggctagacattgctctacatgatacttattatgtggttg
cacatttccattatgtactttctatgggagccgtttttgctttatttgcaggatttcactattgggtgggtaaaatcttt
ggtcggacataccctgaaactttagggcaaatacatttttggatcacttttttcggggttaatctgaccttctttccaat
gcatttcttaggcctttcgggtatgccacgtcgcattccagattatccggatgcttacgctgggtggaatgccattagca
gttttggctcttacatatccgtagttgggattcgtcgtttcttcgtggtcgtaacaatcacttcaagcagtggaaataac
aaaagatgcgctccaagtccttgggctgttgaacagaattcaaccacactggaatggatggtacaaagtcctccagcttt
tcatacttttggagaacttccagctatcaaggaaaccgtgaagtaa
back to top