COX1, COX1 (gene) Prunus dulcis

Gene Overview
Name COX1
Gene Symbol COX1
Type gene
Organism Prunus dulcis
Synonym cytochrome c oxidase subunit I
COXI
Description cytochrome c oxidation
Comment RNA editing may cause alteration of start codon
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1AF149038.1-COX1Prunus dulcisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1AF149038.1-COX1.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome c oxidaseCOXPrunus dulcisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF149038.1-COX1 N/A AF149038.1
mRNA parsed from NCBI nr database AF149038.1-COX1.m1 N/A AF149038.1

Sequence(s):
>AF149038.1-COX1114
atgacacgacggctgttctccactaaccacaaggatatagggactctatatttcatcttcggtgctattgctggagtgat
gggcacatgcttctcagtattgattcgtatggaa
back to top
>AF149038.1-COX1.m1114
atgacacgacggctgttctccactaaccacaaggatatagggactctatatttcatcttcggtgctattgctggagtgat
gggcacatgcttctcagtattgattcgtatggaa
back to top