COX1, COX1 (gene) Rubus allegheniensis

Gene Overview
Name COX1
Gene Symbol COX1
Type gene
Organism Rubus allegheniensis
Synonym cytochrome oxidase subunit 1
COI
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701201.1-COX1Rubus allegheniensisgene
COX1EU701200.1-COX1Rubus allegheniensisgene
COX1EU701199.1-COX1Rubus allegheniensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701201.1-COX1.m1Rubus allegheniensismRNA
COX1EU701200.1-COX1.m1Rubus allegheniensismRNA
COX1EU701199.1-COX1.m1Rubus allegheniensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome c oxidaseCOXRubus allegheniensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU701201.1-COX1 N/A EU701201.1
gene parsed from NCBI nr database EU701200.1-COX1 N/A EU701200.1
gene parsed from NCBI nr database EU701199.1-COX1 N/A EU701199.1
mRNA parsed from NCBI nr database EU701201.1-COX1.m1 N/A EU701201.1
mRNA parsed from NCBI nr database EU701200.1-COX1.m1 N/A EU701200.1
mRNA parsed from NCBI nr database EU701199.1-COX1.m1 N/A EU701199.1

Sequence(s):
>EU701201.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttcctattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagatcacccctatttgtgtggtccgttccagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttctgatcccgctggg
gggggagaccccata
back to top
>EU701200.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttcctattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagatcacccctatttgtgtggtccgttccagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttctgatcccgctggg
gggggagaccccata
back to top
>EU701199.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttcctattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagatcacccctatttgtgtggtccgttccagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttctgatcccgctggg
gggggagaccccata
back to top
>EU701201.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttcctattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagatcacccctatttgtgtggtccgttccagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttctgatcccgctggg
gggggagaccccata
back to top
>EU701200.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttcctattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagatcacccctatttgtgtggtccgttccagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttctgatcccgctggg
gggggagaccccata
back to top
>EU701199.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttcctattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagatcacccctatttgtgtggtccgttccagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttctgatcccgctggg
gggggagaccccata
back to top