COX1, COX1 (gene) Rubus coreanus

Gene Overview
Name COX1
Gene Symbol COX1
Type gene
Organism Rubus coreanus
Synonym cytochrome oxidase subunit I
COI
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1HQ731508.1-COX1Rubus coreanusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1HQ731508.1-COX1.m1Rubus coreanusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome c oxidaseCOXRubus coreanusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HQ731508.1-COX1 N/A HQ731508.1
mRNA parsed from NCBI nr database HQ731508.1-COX1.m1 N/A HQ731508.1

Sequence(s):
>HQ731508.1-COX11584
atgacaaatccggtccgatggctgttctccactaaccacaaggatatagggactctatatttcatcttcggtgccattgc
tggagtgatgggcacatgcttctcagtactgattcgtatggaattagcacgacccggcgatcaaattcttggtgggaatc
atcaactttataatgttttaataacggctcacgcttttttaatgatcttttttatggttatgccggcgatgataggtgga
tttgggaattggtttgttccgattctgataggtgcacctgacatggcatttccacgattaaataatatttcattctggtt
gttgccaccaagtctcttgctcctattaagctcagccttagtagaagtgggtagcgggactgggtggacggtctatccgc
ccttaagtggtattaccagccattctggaggagctgttgatttagcaatttctagtcttcatctatctggtgtttcatcc
attttaggttctatcaattttataacaactatcttcaacatgcgtggacctggaatgactatgcatagattacccctatt
tgtgtggtccgttctagtgacagcattcctacttttattatcacttcccgtactggcaggggcaattaccatgttattaa
ccgatcgaaactttaatacaaccttttttgatcccgctggggggggagaccccatgttataccagcatctcttttggttt
ttcggtcatccagaggtgtatattcccattctgcctggatccggtatcataagtcatatcgtttcgactttttcgggaaa
accggtcttcgggtatctaggcatggtttatgccatgatcagtataggtgttcttggatttcttgtttgggctcatcata
tgtttactgtgggcttagacgttgatacccgtgcctactttaccgcagctaccatgatcatagctgtccccactggaatc
aaaatctttagttggatcgctaccatgtgggggggttcgatacaatacaaaacacccatgttatttgctgtagggttcat
ctttttgttcaccataggaggactcactggaatagtcctggcaaattctgggctagacattgctctacatgatacttatt
atgtggttgcacatttccattatgtactttctatgggagccgtttttgctttatttgcaggatttcactattgggttgga
aaaatctttggtcggacataccctgaaactttaggtcaaatccatttttggatcacttttttcggggttaatctgacctt
ctttcccatgcatttcttagggctttcgggtatgccacgtcgcattccagattatccagatgcttacgctggatggaatg
cccttagcagttttggctcttatatatccgtagttgggattcgtcgtttcttcgtggtcgtaacaatcacttcaagcagt
ggaaataacaaaagatgtgctccaagtccttgggctgttgaacagaattcaaccacactggaatggatggtacaaagtcc
tccagcttttcatacttttggagaacttcctgctatcaaggagacgaaaagctatgtgaagtaa
back to top
>HQ731508.1-COX1.m11584
atgacaaatccggtccgatggctgttctccactaaccacaaggatatagggactctatatttcatcttcggtgccattgc
tggagtgatgggcacatgcttctcagtactgattcgtatggaattagcacgacccggcgatcaaattcttggtgggaatc
atcaactttataatgttttaataacggctcacgcttttttaatgatcttttttatggttatgccggcgatgataggtgga
tttgggaattggtttgttccgattctgataggtgcacctgacatggcatttccacgattaaataatatttcattctggtt
gttgccaccaagtctcttgctcctattaagctcagccttagtagaagtgggtagcgggactgggtggacggtctatccgc
ccttaagtggtattaccagccattctggaggagctgttgatttagcaatttctagtcttcatctatctggtgtttcatcc
attttaggttctatcaattttataacaactatcttcaacatgcgtggacctggaatgactatgcatagattacccctatt
tgtgtggtccgttctagtgacagcattcctacttttattatcacttcccgtactggcaggggcaattaccatgttattaa
ccgatcgaaactttaatacaaccttttttgatcccgctggggggggagaccccatgttataccagcatctcttttggttt
ttcggtcatccagaggtgtatattcccattctgcctggatccggtatcataagtcatatcgtttcgactttttcgggaaa
accggtcttcgggtatctaggcatggtttatgccatgatcagtataggtgttcttggatttcttgtttgggctcatcata
tgtttactgtgggcttagacgttgatacccgtgcctactttaccgcagctaccatgatcatagctgtccccactggaatc
aaaatctttagttggatcgctaccatgtgggggggttcgatacaatacaaaacacccatgttatttgctgtagggttcat
ctttttgttcaccataggaggactcactggaatagtcctggcaaattctgggctagacattgctctacatgatacttatt
atgtggttgcacatttccattatgtactttctatgggagccgtttttgctttatttgcaggatttcactattgggttgga
aaaatctttggtcggacataccctgaaactttaggtcaaatccatttttggatcacttttttcggggttaatctgacctt
ctttcccatgcatttcttagggctttcgggtatgccacgtcgcattccagattatccagatgcttacgctggatggaatg
cccttagcagttttggctcttatatatccgtagttgggattcgtcgtttcttcgtggtcgtaacaatcacttcaagcagt
ggaaataacaaaagatgtgctccaagtccttgggctgttgaacagaattcaaccacactggaatggatggtacaaagtcc
tccagcttttcatacttttggagaacttcctgctatcaaggagacgaaaagctatgtgaagtaa
back to top