COX1, COX1 (gene) Rubus idaeus subsp. strigosus

Gene Overview
Name COX1
Gene Symbol COX1
Type gene
Organism Rubus idaeus subsp. strigosus
Synonym cytochrome oxidase subunit 1
COI
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701206.1-COX1Rubus idaeus subsp. strigosusgene
COX1EU701205.1-COX1Rubus idaeus subsp. strigosusgene
COX1EU701204.1-COX1Rubus idaeus subsp. strigosusgene
COX1EU701203.1-COX1Rubus idaeus subsp. strigosusgene
COX1EU701202.1-COX1Rubus idaeus subsp. strigosusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701206.1-COX1.m1Rubus idaeus subsp. strigosusmRNA
COX1EU701205.1-COX1.m1Rubus idaeus subsp. strigosusmRNA
COX1EU701204.1-COX1.m1Rubus idaeus subsp. strigosusmRNA
COX1EU701203.1-COX1.m1Rubus idaeus subsp. strigosusmRNA
COX1EU701202.1-COX1.m1Rubus idaeus subsp. strigosusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome c oxidaseCOXRubus idaeus subsp. strigosusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU701206.1-COX1 N/A EU701206.1
gene parsed from NCBI nr database EU701205.1-COX1 N/A EU701205.1
gene parsed from NCBI nr database EU701204.1-COX1 N/A EU701204.1
gene parsed from NCBI nr database EU701203.1-COX1 N/A EU701203.1
gene parsed from NCBI nr database EU701202.1-COX1 N/A EU701202.1
mRNA parsed from NCBI nr database EU701206.1-COX1.m1 N/A EU701206.1
mRNA parsed from NCBI nr database EU701205.1-COX1.m1 N/A EU701205.1
mRNA parsed from NCBI nr database EU701204.1-COX1.m1 N/A EU701204.1
mRNA parsed from NCBI nr database EU701203.1-COX1.m1 N/A EU701203.1
mRNA parsed from NCBI nr database EU701202.1-COX1.m1 N/A EU701202.1

Sequence(s):
>EU701206.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701205.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701204.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701203.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701202.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701206.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701205.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701204.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701203.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701202.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top