COX1, COX1 (gene) Rubus occidentalis

Gene Overview
Name COX1
Gene Symbol COX1
Type gene
Organism Rubus occidentalis
Synonym cytochrome oxidase subunit 1
COI
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701210.1-COX1Rubus occidentalisgene
COX1EU701209.1-COX1Rubus occidentalisgene
COX1EU701208.1-COX1Rubus occidentalisgene
COX1EU701207.1-COX1Rubus occidentalisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701210.1-COX1.m1Rubus occidentalismRNA
COX1EU701209.1-COX1.m1Rubus occidentalismRNA
COX1EU701208.1-COX1.m1Rubus occidentalismRNA
COX1EU701207.1-COX1.m1Rubus occidentalismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome c oxidaseCOXRubus occidentalisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU701210.1-COX1 N/A EU701210.1
gene parsed from NCBI nr database EU701209.1-COX1 N/A EU701209.1
gene parsed from NCBI nr database EU701208.1-COX1 N/A EU701208.1
gene parsed from NCBI nr database EU701207.1-COX1 N/A EU701207.1
mRNA parsed from NCBI nr database EU701210.1-COX1.m1 N/A EU701210.1
mRNA parsed from NCBI nr database EU701209.1-COX1.m1 N/A EU701209.1
mRNA parsed from NCBI nr database EU701208.1-COX1.m1 N/A EU701208.1
mRNA parsed from NCBI nr database EU701207.1-COX1.m1 N/A EU701207.1

Sequence(s):
>EU701210.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701209.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctccgccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701208.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctccgccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701207.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701210.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701209.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctccgccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701208.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctccgccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701207.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatcttcaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttcccgtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top