COX1, COX1 (gene) Rubus odoratus

Gene Overview
Name COX1
Gene Symbol COX1
Type gene
Organism Rubus odoratus
Synonym cytochrome oxidase subunit 1
COI
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701212.1-COX1Rubus odoratusgene
COX1EU701211.1-COX1Rubus odoratusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX1EU701212.1-COX1.m1Rubus odoratusmRNA
COX1EU701211.1-COX1.m1Rubus odoratusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome c oxidaseCOXRubus odoratusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU701212.1-COX1 N/A EU701212.1
gene parsed from NCBI nr database EU701211.1-COX1 N/A EU701211.1
mRNA parsed from NCBI nr database EU701212.1-COX1.m1 N/A EU701212.1
mRNA parsed from NCBI nr database EU701211.1-COX1.m1 N/A EU701211.1

Sequence(s):
>EU701212.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701211.1-COX1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701212.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top
>EU701211.1-COX1.m1655
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtactgattcgtatgg
aattagcacgacccggcgatcaaattcttggtgggaatcatcaactttataatgttttaataacggctcacgctttttta
atgatcttttttatggttatgccggcgatgataggtggatttggtaattggtttgttccgattctgataggtgcacctga
catggcatttccacgattaaataatatttcattctggttgttgccaccaagtctcttgctcctattaagctcagccttag
tagaagtgggtagcgggactgggtggacggtctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttctatcaattttataacaactatctccaacat
gcgtggacctggaatgactatgcatagattacccctatttgtgtggtccgttctagtgacagcattcctacttttattat
cacttccggtactggcaggggcaattaccatgttattaaccgatcgaaactttaatacaaccttttttgatcccgctggg
gggggagaccccata
back to top