COX2, COX2 (gene) Rubus coreanus

Gene Overview
Name COX2
Gene Symbol COX2
Type gene
Organism Rubus coreanus
Synonym cytochrome oxidase subunit II
COII
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX2HQ731509.1-COX2Rubus coreanusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COX2HQ731509.1-COX2.m1Rubus coreanusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome c oxidaseCOXRubus coreanusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HQ731509.1-COX2 N/A HQ731509.1
mRNA parsed from NCBI nr database HQ731509.1-COX2.m1 N/A HQ731509.1

Sequence(s):
>HQ731509.1-COX2768
atgattgttctagaatggctattcctcacaattgctccttgtgatgcagcggaaccatggcaattaggatttcaagacgc
agcaacccctatgatgcaaggaataatggacttacatcacgatatctttttcttcctcattctgattttggttttcgtat
cacggatcttggttcgcgctttatggcatttccactataaaaaaaatccaatcccgcaaaggattgttcatggaactact
atcgagattcttcggaccatatttcctagtatcatcccgatgttcattgctataccatcatttgctttgttatactcaat
ggacgaggtagtagtagatccagccattactatcaaagctattggacatcaatggtatcggacttatgagtattcagact
ataacagttccgatgaacagtcactcacttttgacagttatacgattccagaagatgatctagaattgggtcaatcgcgt
ttattagaagtggacaatagagtggttgtaccagccaaaactcatctacgtattattgtaacacctgctgatgtacttca
tagttgggctgtaccttcctcaggtgtcaaatgtgatgctgtacctggtcgtttaaatcagatctctatttcggtacaac
gagaaggagtttactatggtcagtgcagtgagatttgtggaactaatcatgcctttacgcctatcgtcgtagaagctgtt
cctaggaaagattatggttctcgggtatccaatcaattaatcccataa
back to top
>HQ731509.1-COX2.m1768
atgattgttctagaatggctattcctcacaattgctccttgtgatgcagcggaaccatggcaattaggatttcaagacgc
agcaacccctatgatgcaaggaataatggacttacatcacgatatctttttcttcctcattctgattttggttttcgtat
cacggatcttggttcgcgctttatggcatttccactataaaaaaaatccaatcccgcaaaggattgttcatggaactact
atcgagattcttcggaccatatttcctagtatcatcccgatgttcattgctataccatcatttgctttgttatactcaat
ggacgaggtagtagtagatccagccattactatcaaagctattggacatcaatggtatcggacttatgagtattcagact
ataacagttccgatgaacagtcactcacttttgacagttatacgattccagaagatgatctagaattgggtcaatcgcgt
ttattagaagtggacaatagagtggttgtaccagccaaaactcatctacgtattattgtaacacctgctgatgtacttca
tagttgggctgtaccttcctcaggtgtcaaatgtgatgctgtacctggtcgtttaaatcagatctctatttcggtacaac
gagaaggagtttactatggtcagtgcagtgagatttgtggaactaatcatgcctttacgcctatcgtcgtagaagctgtt
cctaggaaagattatggttctcgggtatccaatcaattaatcccataa
back to top