CRY1, CRY1 (gene) Fragaria vesca

Gene Overview
Name CRY1
Gene Symbol CRY1
Type gene
Organism Fragaria vesca
Synonym CRY1
Description NA
Comment blue light photoreceptor; FvCRY1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cryptochromeCRYFragaria vescagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CRY1GQ497942.1-CRY1.m1Fragaria vescamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GQ497942.1-CRY1.m1 LG5:27617863..27621219
GQ497942.1

Sequence(s):
>GQ497942.1-CRY1.m12022
atgtcaggtggtagtggttgcagtgtagtttggttcaggagagatctgagggttgaagacaatccagctttgttagctgg
agttagagcaggaggagttgttgctctttttatttgggcacctgaggaagaagggccttattacccaggaagggtctcaa
ggtggtggctcaaacacagtttggcacatcttgattcctctttgagaagtttgggcactcctctcatcaccaaaaaatct
actgacagtgtttcttctcttcttgaggtttgtcttgcaactggagccactcagctcttcttcaaccacttatatgatcc
tatatcactggttagagatcacagggccaaggaggttttgtccgccaacggcataactgtgcgttcctttaacgccgatt
tgctctatgaaccatgggatgttaatgatgtccacggtcgtccattcacaacctttgatgctttttgggaaagatgcctc
agcatgccctttgatccagaggcaccacttctcccccctaagagaatcatatcaggtgatgcatcaaggtgtcctcctga
tacattggtttttgaagatgaatcagagaagggaagcaatgcgctacttgctcgagcatggtcacctgggtggagcagtg
ctgataaggcagtaaccacatttattaatggtccattgatcgagtattccacaaaccgcagaaaggctgatagtaataca
acttcactgctttctccccatttgcattttggggaggtaagtgtcagaaaagtatttcatcttatacgcatcaagcagtt
gctttgggccaatgaaggtaacaaggctggtgaagagagtgtgaacttgtttctgaaatctattggtcttagggagtatt
caagatacattagtttcaatcatccttacagtcatgaaagacctcttcttgggcacctaaaattcttcccctgggttata
aatcagaactatttcaaggcatggaggcaaggtcgaactggctatccgttggtggatgctggcatgagagaattgtgggc
tactggctggctgcatgatcggatacgagttgttgtttctagtttcttcgtaaaggttctgcagctcccgtggaggtggg
gaatgaagtatttctgggacacactcttagatgctgatcttgaaagtgatgctcttggttggcagtatatatccggcact
atccctgatgggcgtgagtttgaccgcatagataatccacagtttgagggttacaagtgtgatccacatggagaatatgt
gcgaaggtggcttcctgaactatccaggctaccaactgactggatacaccacccatggaatgcaccagagtctgtactcc
aggcagctggaattgaacttggatcaaattacccccttcctattgtaggaatagaagcagcaaaatccaggttgcaagaa
gcgttaactgaaatgtggcagcatgaacgagccgctgctgagaatggaactgaagaagggctcggagagtcttctgaatc
aacctccattgcgtttcctgaagacatacaaatggaggatagtcatgaacaggtgaggaataaccctcctcctccaactc
gacgctatgaggatcagatggtccctagtatcactacttccctcgtgcgagttgaagaggaagaaagttctttggatctt
ccaagcagagctgaagtgcctacaaatgttactggggatcaagaaccaatgagagacacaatgaaccaagagggttttca
gcctaatcataacaacactccaccacaacctaatactacactaaccctgcagtatgttgttgaagattcgacggcggaat
cgtctagcagtactaggagagagagggatggaggtgtagttccagtttggtctccttcaaattctagctactcagagcag
tttgtgagtgatgaaaatggcattgcaacaagttcttacttgcagagacatcctcagtctcaccaaataatgaattggag
gcggctatctcaaactgggtaa
back to top