CRY1, CRY1 (gene) Fragaria x ananassa

Gene Overview
Name CRY1
Gene Symbol CRY1
Type gene
Organism Fragaria x ananassa
Synonym cryptochrome1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CRY1AB743569.1-CRY1.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cryptochromeCRYFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB743569.1-CRY1.m1 LG5:27617863..27621219
AB743569.1

Sequence(s):
>AB743569.1-CRY1.m12022
atgtcaggtggtagtggttgcagtgtagtttggttcaggagagatctgagggttgaagacaatccagctttgttagctgg
agttagagcaggaggagttgttgctctttttatttgggcacctgaggaagaagggcctttttacccaggaagggtctcaa
ggtggtggctcaaacacagtttggcacatcttgattcctctttgagaagtttgggcactcctctcatcaccaaaaaatct
actgacagtgtttcttctcttcttgaggtttgtcttgcaactggagccactcagctcttcttcaaccacttatatgatcc
tatatcactggttagagatcacagggccaaggaggttttgtccgccaacggcataactgtgcgttcctttaacgccgatt
tgctctatgaaccatgggatgttaatgatgtccacggtcgtccattcacaacctttgatgctttttgggaaagatgcctc
agcatgccctttgatccagaggcaccacttctcccccctaagagaatcatatcaggtgatgcatcaaggtgtcctcctga
tacattggtttttgaagatgaatcagagaagggaagcaatgcgctacttgctcgagcatggtcacctgggtggagcagtg
ctgataaggcagtaaccacatttattaatggtccattgatcgagtattccacaaaccgcagaaaggctgatagtaataca
acttcactgctttctccccatttgcattttggggaggtaagtgtcagaaaagtatttcatcttatacgcatcaagcagtt
gctttgggccaatgaaggtaacaaggctggtgaagagagtgtgaacttgtttctgaaatctattggtcttagggagtatt
caagatacattagtttcaatcatccttacagtcatgaaagacctcttcttgggcacctaaaattcttcccctgggttata
aatcagaactatttcaaggcatggaggcaaggtcgaactggctatccgttggtggatgctggcatgagagaattgtgggc
tactggctggctgcatgatcggatacgagttgttgtttctagtttcttcgtaaaggttctgcagctcccgtggaggtggg
gaatgaagtatttctgggacacactcttagatgctgatcttgaaagtgatgctcttggttggcagtatatatccggcact
atccctgatgggcgtgagtttgaccgcatagataatccacagtttgagggttacaagtgtgatccacatggagaatatgt
gcgaaggtggcttcctgaactatccaggctaccaactgactggatacaccacccatggaatgcaccagagtctgtactcc
aggcagctggaattgaacttggatcaaattacccccttcctattgtaggaatagaagcagcaaaatccaggttgcaagaa
gcgttaactgaaatgtggcagcatgaacgagccgctgctgagaatggaactgaagaagggctcggagagtcttctgaatc
aacctccattgcgtttcctgaagacatacaaatggaggatagtcatgaacaggtgaggaataaccctcctcctccaactc
gacgctatgaggatcagatggtccctagtatcactacttccctcgtgcgagttgaagaggaagaaagttctttggatctt
ccaagcagagctgaagtgcctacaaatgttactggggatcaagaaccaatgagagacacaatgaaccaagagggttttca
gcctaatcataacaacactccaccacaacctaatactacactaaccctgcagtatgttgttgaagattcgacggcggaat
cgtctagcagtactaggagagagagggatggaggcgtagttccagtttggtctccttcaaattctagctactcagagcag
tttgtgagtgatgaaaatggcattgcaacaagttcttacttgcagagacatcctcagtctcaccaaataatgaattggag
gcggctatctcaaactgggtaa
back to top