CSDB, CSDB (gene) Prunus persica

Gene Overview
Name CSDB
Gene Symbol CSDB
Type gene
Organism Prunus persica
Synonym copper/zinc-superoxide dismutase
CSD-b
Description NA
Comment Cu/Zn SOD
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CSDBJQ764840.1-CSDB.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
copper/zinc-superoxide dismutaseCSDPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JQ764840.1-CSDB.m1 scaffold_6:8123700..8125634
JQ764840.1

Sequence(s):
>JQ764840.1-CSDB.m1651
atggcagcccacactttgatgctctcaacctactcatctcccactctcttctcccaaattcaaagccctaactctcaccc
acttcctcactcctccttccatggcctctctgttaagctcccactcaaatcccaattccaatccatgtctctcgccgcag
cccataagcctctcactgtggttgctgccaccaagaaagccgtcgctgtcctcaagggcaattccagtgtcgaaggggtc
gtcaccttaagccaagaagacgatggkcctacaactgtgaatgttcgtattacaggacttactcctgggcctcatgggtt
ccacttacatgagtacggtgacacaacaaatggatgcatatccacaggaccacatttcaatcctaaaaatttgacacatg
gtgctcctgaggatgaaatccgtcatgcgggtgacctgggaaacatagttgctaatgccgatggggtggcagaggcaaca
atcgtggataaccagattccattaactggtcctaatgctgtaattggaagagcacttgtcgttcatgagcttgtggatga
ccttggaaagggtggacacgagcttagtctaagcactggcaatgcaggtggaagattggcatgtggtgtggttggtttga
caccagtgtaa
back to top