CWINV, CWINV (gene) Fragaria x ananassa

Gene Overview
Name CWINV
Gene Symbol CWINV
Type gene
Organism Fragaria x ananassa
Synonym cell wall invertase precursor
cell wall invertase
INV
Description sucrose hydrolysis
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cell wall acid invertaseCWINVFragaria x ananassagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CWINVAF000521.1-CWINV.m1Fragaria x ananassamRNA
CWINVAF000520.1-CWINV.m1Fragaria x ananassamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AF000521.1-CWINV.m1 LG4:23090885..23094405
AF000521.1
mRNA parsed from NCBI nr database AF000520.1-CWINV.m1 LG4:23090885..23093429
AF000520.1

Sequence(s):
>AF000521.1-CWINV.m11734
atgatattctctctttggcaattctgccttctttcacttttgctttcttttggtgttattgagcttcaagcttcccacca
tgtctatagcaaccttcaaactacccaacttgcttcaacacatccccaagctaaagacccttacagaactggttatcatt
tccagcctcgcaagaattggatcaatgatccaaatgggccactgatttacaagggcatttaccatcttttctatcagtac
aatcccagcagtgtagtttggggtaacattgtttgggcacattccacatccactgatctcgtcaactggattccacatga
agctgctatctacccatcaattctctccgatatcaatggctgttggtcggggtccgtcacaatccttcccagcggaaagc
cggccattttatacaccggaatcaaccccgacaaagaacaagttcaaaacttggcatttccaaaaaacctttccgaccca
tttcttagggagtgggttaaagtcccacaaaaccctctaatggctccaactcaagctaaccaaatcaatgccagctcatt
tagggatcctaccactgcttggctagggccagataagagatggaggttgatcattggaagcaaaaggaaccacaggggac
tagctatcctctacagaagcaaagatttcatgcattggactaaggctaaacatccattatattcaacgccaaaaaatggt
atgtgggaatgccctgattttttcccagtttcgaagactaagttgcttggtcttgacacatctgcaattggtccggatgt
taagcatgtactcaaagttagcttggacaacactaggaaagagtactacacaattggtacatataatgtgagcaaggata
tctatatcccagatgatggatcaattgagagtgattctggtttgagatatgattatggtaagttttatgcttcaaaaact
ttctttgacagtgctaagaaccgcagaatcttgtggggttggatcaatgagtcctcaagtgttagtggtgacatcaagaa
aggatggtctggactccaggcaattccaaggactattgtgctcgacaaatctagaaagcaattggtgcaatggcctgtag
tggagcttgagaaacttagaacaaacgaggtcaagttaccaagcactctccttaaaggaggatcacttcatgaagtcatt
ggtgtcacagcagcacaggctgatgtagatgttgcatttgagataagtgatctcaagaaagcagaagttatggatccaag
ttggactaatgcacaacttttgtgtagtaaaaagggtacctcagtgaaaggggctctaggaccatttggattgttggcat
ttgtttcaaaggatttgaaagaaaagacagcaatcttctatagaattttcaagtctcacaacaataacaacaaatatgtg
gttcttatgtgcagtgaccaaagcaggtcttccctaaacccagataatgatatgacaacttatggaacatttgtaaacgt
ggatcctcttcatgaaaaattgtcactaagaagcttgattgatcactctatagtggagagttttggtggaaaaggcaagg
agtgcataacagctagggtgtatcctacattggctgttgatggtgatacccatttatatgctttcaattatggaagtgag
agtgtcaaaatcgcaggaagtgcatggagcatgaaaactgctaaaatcaattga
back to top
>AF000520.1-CWINV.m11215
atggctccaactcaagctaaccaaatcaatgccagctcatttagggatcctaccactgcttggctagggccagataagag
atggaggttgatcattggaagcaaaaggagccaaaggggactagctatcctctacagaagcaaagatttcatgcattgga
ctaaggctaaacatccattatattcaacaccgaaaaatggtatgtgggaatgccctgattttttcccagtttcgaagact
aagttgcttggtcttgacacatctgcaattggtccggatgttaagcatgtactcaaagttagcttggacaacactaggaa
agagtactacacaattggtacatataatgtgagcaaggatatctatatcccagatgatggatcaattgagagtgattctg
gtttgagatatgattatggtaagttttatgcttcaaaaaccttctttgacagtgctaagaaccgcagaatcttgtggggt
tggatcaatgagtcctcaagtgttagtggtgacatcaagaaaggatggtctggactccaggcaattccaaggactattgt
gctcgacaaatctggaaagcaattggtgcaatggcctgtagtagagcttgagaaacttagaacaaacgaggtcaagttac
caagcactctccttaaaggaggatcacttcatgaagtcattggtgtcacagcagcacaggctgatgtagatgttgcattt
gagataagtgatctcaagaaagcagaagttatggatccaagttggactaatgcacaacttttgtgtagtaaaaagggtac
ctcagtgaaaggggctctaggaccatttggattgttggcatttgtttcaaaggatttgaaagaaaagacagcaatcttct
atagaattttcaagtctcacaacaataacaacaaatatgtggttcttatgtgcagtgagcaaagcagatcttccctaaac
ccagataatgatatgacaacttacggagtatttgtaaatgtggatcctcttcatgaaaagctgtcattaagaagtttgat
tgatcactctatagtggagagttttggtggaaaaggcaaggcgtgcataacagctagggtgtatcctacaatgactgttg
atggtgatacccatttatatgcattcaattatggaagtgagagtgtcaaaatcgcaggaagtgcatggagcatgaaaact
gctcaaatcaattga
back to top