CWINV, CWINV (gene) Malus x domestica

Gene Overview
Name CWINV
Gene Symbol CWINV
Type gene
Organism Malus x domestica
Synonym cell wall invertase
CWI
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CWINVJX459588.1-CWINV.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cell wall acid invertaseCWINVMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JX459588.1-CWINV.m1 Chr09:17088856..17092838
chr13:29307868..29311850
chr13:33269298..33273280
JX459588.1

Sequence(s):
>JX459588.1-CWINV.m11734
atggccatctcctctctctttctctactgctttctctgtctttggctaggccatgctgttcttcggcttgaagcttccca
ccatgtttacagaagccttcaaacttattccgagctaacttcctcacatcatcacccagatactgaaccctacagaactg
gttatcatttccaacctcccaagaactggatcaatgatcctaatggaccattgatttacaagggaatttaccatctcttc
tatcaatacaaccctaaaggtgtggtttgggggaacattgtgtgggctcattccacatcaactgatcttgttaactggac
cccacatgatgctgccatcttcccatcgcagccgtccgatatcaacggctgttggtcgggttccgccaccatcctcccga
gtggcaaaccggtcattttgtataccggaatcaacccccaaaaccagcaggttcagaatttggcctatcccaagaacctc
tcagacccatttcttagggagtgggtcaaggtcccacaaaatcccctaatggcacccacccaagctaaccatatcaacgc
aagctcatttagggaccccacaactgcttggttgggcccagataagagatggagagtgatcattggaagcaagcagaacc
aaagaggattagctatcctatacaggagtaaagatttcctttcttgggttaaggccaaacacccccttcactcagccaag
aaaactggaatgtgggaatgtccagattttttcccagtttcaatccatggccagaatggtcttgactcatcagaaaatgg
tcctgctgtcaaacatgtgctcaaggctagcctggataacactaaacatgagtactacacaattgggacttataacattg
acaaggatatatatattccggataagggttcagtggagagtgactcaggcttgagatatgattatggaaagttttatgct
tcaaaaactttctttgacagttctaagaatcggaggatattgtggggttggattaatgaatcgtcgagcgtcgagggtga
tatcaagaagggatggtctggacttcaggcaattccaagaaccctatggctcgccaaatccgggaaacagttggtgcaat
ggccagtacaagaaattgaaaagctacgtggaaaaacggtcaagttgccaagcactgtgcttaagggaggatcggtgcgt
gaggtagttggtgtcactgcagcacaggcagatgtggagattacattcggaataagtgattttaagaaagcagaagttct
tgaccctagttggacggacccccaacttttgtgtggccaaaaaagtgccacagttaaaggtagtttaggaccatttggac
tgtatgttttggcttccaaggacttgaaagaatacacagcagtgttctatagaatattcaaagccaataacaaatatgtg
gtgctcctctgcagtgatcaaagccggtcttccttaaataaggataatgataagaccacttatggagcttttgtaaaggt
ggatcctcttcgtgagaagctgtcgctaagaaatttgattgatcactcaattgtggagagctttggtggagaaggcaagg
cgtgcataacagctagggtttatcccacattggccattgacgatgatgctcacttgtatgccttcaattatggaacagaa
gatgtaaaaatcacagggagtgcatggagcttgaaaacagcaaaaatcaattga
back to top