CWINV, CWINV (gene) Pyrus pyrifolia var. culta

Gene Overview
Name CWINV
Gene Symbol CWINV
Type gene
Organism Pyrus pyrifolia var. culta
Synonym cell wall acid invertase
PsCW-AIV
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cell wall acid invertaseCWINVPyrus pyrifolia var. cultagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CWINVAB266451.1-CWINV.m1Pyrus pyrifolia var. cultamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB266451.1-CWINV.m1 scaffold00100:200813..201297
AB266451.1

Sequence(s):
>AB266451.1-CWINV.m1491
tttggggtaacattgtgtgggctcattccacatcaactgatcttgttaactggaccccacatgatgctgccatcttccca
tcacagccgtccgatatcaacggctgttggtcgggttccgccaccatcctcccgagtggcaaaccggtcattttgtacac
cggaatcaacccccaaaaccagcaggttcaaaatttggccttccccaagaacctctcagacccatttcttagggagtggg
tcaaggtcccacaaaatcccctaatggcacccacccaagctaaccgtatcaacgcaagctcatttagggaccccacaact
gcttggttgggcccagataagagatggagagtgatcattggaagcaagcagaaccaaagaggattagctatcctatacag
gagtaaagatttccttcattgggttaaggccaaacacccccttcactcggccaagaaaactggaatgtgggagtgtccgg
atttctaccca
back to top