CYP1, CYP1 (gene) Prunus dulcis

Gene Overview
Name CYP1
Gene Symbol CYP1
Type gene
Organism Prunus dulcis
Synonym cysteine protease
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cysteine proteaseCYPPrunus dulcisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CYP1AF213939.1-CYP1.m1Prunus dulcismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AF213939.1-CYP1.m1 scaffold_7:19055038..19055929
AF213939.1

Sequence(s):
>AF213939.1-CYP1.m1536
gaccaaggtcactgtggatcttgctggacattcagcaccactggggctcttgaggcagcttatgtgcaggcattcggaaa
gcaaatctctctctctgagcagcagcttgtggattgtgctggagctttcaataactttggctgccatggtgggttgccat
ctcaagcttttgagtacatcaaatacaacggcggtctcgacaccgaggctgcatatccttacgttggaaccgacggggct
tgcaaattttcagctgaaaacgttggtgcccaagtgctcgactctgtcaatatcaccctgggtgatgaacaagaactaaa
gcatgcagttgcgtttgtgcggccagtcagcgtcgcctttcaggtggtcaaaagtttccgattttacaagtcgggagtct
acaccagtgacacttgtggcagcagtcccatggatgtgaaccatgctgttcttgcagttgggtatggagaggaaggcggt
gtccccttctggctcatcaagaactcttggggagaaagctggggtgacaatggcta
back to top