CYP51, CYP51 (gene) Fragaria vesca

Gene Overview
Name CYP51
Gene Symbol CYP51
Type gene
Organism Fragaria vesca
Synonym CYP51 protein
Description sterol biosynthesis
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CYP51HE802702.1-CYP51Fragaria vescagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CYP51HE802702.1-CYP51.m1Fragaria vescamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cysteine proteaseCYPFragaria vescagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HE802702.1-CYP51 N/A HE802702.1
mRNA parsed from NCBI nr database HE802702.1-CYP51.m1 N/A HE802702.1

Sequence(s):
>HE802702.1-CYP512202
atggatgtggacaccaagcttctagatggggctctgccggttgtggcggctctggtgttggctgtccttatcggagttac
tatactccgacgccgatctggacaccggcttcctccgactgtaaaggccttgcctttgattggagggttgatgaggttct
tgaagggtcccattgtgatgatcagggaggagtaccctaagcttgggagtgtgttcacattgaacttgtttcacaagaag
attactttcttgattggtcctgaggtttcggcgcactttttcaaggcgccggagtctgatcttagccagcaggaggtgta
ccagttcaatgtgcccactttcggaccgggagttgtgtttgatgtggattatactgtgaggcaggagcagtttaggttct
ttacggaggctttgagggtcaataagctcaaggggtatgtggatcagatggttacagaagcagaggtacatttcgattct
agtgttggtaactttggttggtttgttattgcattgtttgtttgatcttctttgatgtgattagtaacttcactaacttg
tttacgtgcttaggtctagggactagtttgattgaatgttggtcaatgtttgataagaagaatctcacttgtgcggtttc
tatgtgttgaatgtgtgattgttgcttaaatcattagcaatcattggcagggttttctgttcactatagactatgcaaga
aatagagtagcctttaagacaagtgctttatgttttaacccaaaaaaataaaatataagagggaagacagatgcagcatg
tgtattaagggtttcctgataaccatatagagttctctaatatttggtaactggatttcaacagtccctcccctcactgt
tgaaaaaggttaactaaacttctgatatatgcatctaagaagacacaaggcatgttcttttatctttaagagtcataatg
aaagtcattcatcaccaaacatcaaatagttgcacataagtcggggaaaaataggatttcattggttacctctctatgct
aatattcagtctaagcactcgctcaaaacttgcttgtatttggtttagtaaagaactaaagataattataaactttgaac
gtataatttgtgcatggtacctggtggcagaatacttatacataatgttggattaactcatgtcttcaaactgtactgga
caggattacttttctaagtggggagacagtggagaggtagacttgaagtatgagctggagcatctgattatcctaacagc
cagtagatgcctcttgggtcgtgaagttcgtgataagctctttgatgatgtttcgtctttgttccatgaacttgacaatg
gcatgcttcccattagtgtcatcgccccatacctgcccatcccagctcaccgccgccgtgaccaggcccgcaagaagctt
acagcaatctttgcaaacatcataaactcccgcagatgtgctaaggtgtctgagaatgacatgttgcaatattttatcga
gtctaagtacaaaaacggccgaaaaacaactgattctgagatcactggtttgctcattgctgctctctttgctggccaac
atacaagttctatcacttccacttggactggggcttatctcctccggaacaaacagtacctatctgccgtgtcagacgag
cagaaaaggcttatggctaagcatgggaagaagattgatcatgatatattgtccgagatggacacactctatcgttgcat
caaggaagctctgagactgcaccctccactgatcatgttgctacgacactcgcatagtgatttcagcgtacaaactcgtg
atgggaaagaatatgacatcccgaagggccacatagttgccacatcaccagcttttgccaaccgacttcctcatatcttc
acgaacccagacagctacgatcctgatagatttgctgttgggagggaggaagacaaggctgcaggggctttctcgtatat
ctcatttggaggtggcaggcatggatgccttggagagccttttgcatacctgcagattaaggctatatggagtcatttgc
taaggaactttgaaatggagctaatttcaccatttccagagactgattggaatgccatggttgtcggtgtgaaaggaaag
gtgatggttcggtacaagcgaagggagctttcagctaactaa
back to top
>HE802702.1-CYP51.m11464
atggatgtggacaccaagcttctagatggggctctgccggttgtggcggctctggtgttggctgtccttatcggagttac
tatactccgacgccgatctggacaccggcttcctccgactgtaaaggccttgcctttgattggagggttgatgaggttct
tgaagggtcccattgtgatgatcagggaggagtaccctaagcttgggagtgtgttcacattgaacttgtttcacaagaag
attactttcttgattggtcctgaggtttcggcgcactttttcaaggcgccggagtctgatcttagccagcaggaggtgta
ccagttcaatgtgcccactttcggaccgggagttgtgtttgatgtggattatactgtgaggcaggagcagtttaggttct
ttacggaggctttgagggtcaataagctcaaggggtatgtggatcagatggttacagaagcagaggattacttttctaag
tggggagacagtggagaggtagacttgaagtatgagctggagcatctgattatcctaacagccagtagatgcctcttggg
tcgtgaagttcgtgataagctctttgatgatgtttcgtctttgttccatgaacttgacaatggcatgcttcccattagtg
tcatcgccccatacctgcccatcccagctcaccgccgccgtgaccaggcccgcaagaagcttacagcaatctttgcaaac
atcataaactcccgcagatgtgctaaggtgtctgagaatgacatgttgcaatattttatcgagtctaagtacaaaaacgg
ccgaaaaacaactgattctgagatcactggtttgctcattgctgctctctttgctggccaacatacaagttctatcactt
ccacttggactggggcttatctcctccggaacaaacagtacctatctgccgtgtcagacgagcagaaaaggcttatggct
aagcatgggaagaagattgatcatgatatattgtccgagatggacacactctatcgttgcatcaaggaagctctgagact
gcaccctccactgatcatgttgctacgacactcgcatagtgatttcagcgtacaaactcgtgatgggaaagaatatgaca
tcccgaagggccacatagttgccacatcaccagcttttgccaaccgacttcctcatatcttcacgaacccagacagctac
gatcctgatagatttgctgttgggagggaggaagacaaggctgcaggggctttctcgtatatctcatttggaggtggcag
gcatggatgccttggagagccttttgcatacctgcagattaaggctatatggagtcatttgctaaggaactttgaaatgg
agctaatttcaccatttccagagactgattggaatgccatggttgtcggtgtgaaaggaaaggtgatggttcggtacaag
cgaagggagctttcagctaactaa
back to top