CYP, CYP (gene) Fragaria x ananassa

Gene Overview
Name CYP
Gene Symbol CYP
Type gene
Organism Fragaria x ananassa
Synonym cysteine protease
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CYPJN979371.1-CYP.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cysteine proteaseCYPFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JN979371.1-CYP.m1 LG6:35085956..35088200
JN979371.1

Sequence(s):
>JN979371.1-CYP.m11065
atgtcgacctccatgaccctaaccctcttcaccctcctcttcctctccttcaccctctctcacgcctccgacctccgcac
cgatgccgaggtccgggagctctaccagaactggctcgtcaagcaccagaaagtctacaacggcatcggagaggaggaga
ccaggttccagatcttcaaggacaacttgaagttcgtcgatgaacacaacgctgagagcaggtcgtacaaggttggcatg
aacgccttcgccgacttgaccaaccaggagtaccgtgctaggtttctcggaacccgccctgaccctaagaggagggtcat
gaaggccaagaaccccagcctcaggtacgttgtccgccccgacgacaagttgccggaatccgtcgactggagagctttgg
gggctgttaacccgatcaaaaaccaaggcagctgcggaagttgctgggcattttcaactgtggctgcagtggaaggcatt
aacaagatagccacaggagaactagtctctctttcagagcaagagcttgttgactgtgacaggaagtacaacgctggctg
caacggaggccttatggactatgctttcgagttcatcatcaaaaacggtggcatggacaccgaatcagactacccttaca
aagcagtcaaccaacagtgtgacgcttctttggagaacaacaaggttgttaccattgatggttacgaagatgttccagct
ttcaacgaggaggctttgaagaaagctgtagcacatcaacctgtaagtgttgccattgaagctggtggcgttgctcttca
gctctatgactcgggtgtgtttaccggtgaatgtggatcagcacttgatcatggtgtggttgctgttggttatggcactg
agaatggtgtggactactggctggtgaggaactcatggggaaccaactggggtgagggtggatatttcaagatcgagcgc
aatgtgaagagcacatatactggcaagtgtggtattgccatggaggcttcttacccgaccaaggatagtgcacagaaccc
aatccagatggtcaccagcatgtga
back to top