DAD-1, DAD-1 (gene) Malus x domestica

Gene Overview
Name DAD-1
Gene Symbol DAD-1
Type gene
Organism Malus x domestica
Synonym defender against cell death 1 homolog
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DAD-1U68560.1-DAD-1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Defender against Apoptotic DeathDADMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly U68560.1-DAD-1.m1 Chr05:1792105..1793602
chr5:30922823..30924320
chr5:36683262..36684759
U68560.1

Sequence(s):
>U68560.1-DAD-1.m1360
atggggaaagcatcacactcgtcaacggcccaggatgcggttgctctcttcgattctcttcgctcagcttactccgccac
tcccaccactctcaagatcattgatctctatattgggttcgccgtatccacagctcttatccaggtagtctacatggcta
ttgtcgggtcattcccattcaactctttcctttcaggagtactttcttgcatcgggacggcagtccttgctgtttgtctc
cgtattcaagtgaacaaagaaaataaagaatttaaggatttagcaccggaacgggcttttgcagattttgttctctgcaa
cttggtgctgcatatggtgatcatgaatttccttggataa
back to top