DAD, DAD (gene) Malus hupehensis var. mengshanensis

Gene Overview
Name DAD
Gene Symbol DAD
Type gene
Organism Malus hupehensis var. mengshanensis
Synonym defender against cell death 1
Description NA
Comment anti-apoptosis
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DADJN390964.1-DAD.m1Malus hupehensis var. mengshanensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Defender against Apoptotic DeathDADMalus hupehensis var. mengshanensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JN390964.1-DAD.m1 Chr10:811585..813405
chr10:118092..119912
chr10:118092..119912
JN390964.1

Sequence(s):
>JN390964.1-DAD.m1360
atggtgaaagcatcgtcgtcgtcaacggcccaggacgcgcttgcccttttcgattctctccgctctgcttactccgccac
tcccaccactctcaagatcattgatctctatattgggttcgccgtatccactgccctcatccaggtagtctacatggctc
ttgttggatcattcccattcaactcttttctttctggagtactttcttgcgtagggacagcagtccttgctgtttgtctc
cgtattcaagtgaacaaagaaaacaaagaatttaaggatttagcacctgaacgggcttttgctgattttgttctctgcaa
tgtggtgctgcatttggtgatcatgaatttccttggataa
back to top