DREB1B, DREB1B (gene) Rosa hybrid cultivar

Gene Overview
Name DREB1B
Gene Symbol DREB1B
Type gene
Organism Rosa hybrid cultivar
Synonym dehydration-responsive element-binding protein 1B
Rh-DREB1B
Description NA
Comment Rh-DREB1B
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBRosa hybrid cultivargene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB1BEU784070.1-DREB1B.m1Rosa hybrid cultivarmRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU784070.1-DREB1B.m1 N/A EU784070.1

Sequence(s):
>EU784070.1-DREB1B.m1696
atggatggtggattttcagctttccctcagtactatgatcataacacgcagtacccatttggttcggatttgccggaatc
atcgtctcattctgacaacaacagcggtaatggcgttggtaggatgaacttgtcggacgaggaggtcatgctggcggcga
cgtacccgaagaagagggcgggaaggaagaagttcaaggagacgaggcacccggtgtaccgcggcgtaaggaggaggaac
tccgggaagtgggtttgcgaggttcgtgagccgaataagaagacgagaatctggctcgggactttccccactgcagaaat
ggcggcgcgtgctcacgacgtggcggcgatttccttgagggggcggtctgcttgcttgaatttcgcggactcggcttggc
ggctgccggtgccggcttctactagtgctaaggacatacagacggcggctgctcaggcggctgaggcgttccggccgacc
ggggaggaatcggaagttgtttcgggatcggtcacggcgacggaagcggaattggaaccggtgttttgtatggacgagga
ggatgtgtttgggatgccggggttgctggcaaacatggcggaagggatgctactgtcacctcctcattataatagctacg
gcggcgatgacatggaaggttatgctgacgtgtcactgtggagttactccatttag
back to top