DREB1L, DREB1L (gene) Prunus avium

Gene Overview
Name DREB1L
Gene Symbol DREB1L
Type gene
Organism Prunus avium
Synonym dehydration responsive element binding protein 1 like protein
dehydratiion responsive element binding protein 1 like protein
DREB1-like
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB1LAB080967.1-DREB1LPrunus aviumgene
DREB1LAB080966.1-DREB1LPrunus aviumgene
DREB1LAB080965.1-DREB1LPrunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB1LAB080967.1-DREB1L.m1Prunus aviummRNA
DREB1LAB080966.1-DREB1L.m1Prunus aviummRNA
DREB1LAB080965.1-DREB1L.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB080967.1-DREB1L N/A AB080967.1
gene parsed from NCBI nr database AB080966.1-DREB1L N/A AB080966.1
gene parsed from NCBI nr database AB080965.1-DREB1L N/A AB080965.1
mRNA parsed from NCBI nr database AB080967.1-DREB1L.m1 N/A AB080967.1
mRNA parsed from NCBI nr database AB080966.1-DREB1L.m1 N/A AB080966.1
mRNA parsed from NCBI nr database AB080965.1-DREB1L.m1 N/A AB080965.1

Sequence(s):
>AB080967.1-DREB1L390
atggacgtgtctcaactttccgactcggtcgaccagcccgagtcgagttctttgtccgacgtcagcttcaagactcgggg
gccttcttggtccgacggggaagtcatattggcgtcaagccggccgaagaagcgagccgggaggagggttttcaaggaga
cgaggcaccccgtttataggggtgtgaggaggaggaacaatgacaagtgggtttgtgaaatgagagagcccaacaacaag
aagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggccgcattggcgtttag
agggaagcttgcctgcctcaactttgctgactccgcgtggaggctgcccgtgccggcttccatggatcga
back to top
>AB080966.1-DREB1L723
atggacatgttcttctctcaactttcagactcggtcgaccagccccagtcgagtttgttgtccgacgccagcgtcaccac
tcgaggggcttcttgttccgacggggacgtcatattggcgtcgagccggccgaagaagcgagcggggaggagggttttca
aggagacgaggcacccggtttataggggtgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaac
aagaagaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggccgcattggc
gtttagagggaagcttgcatgcatcaactttgctgactcagcgtggaggctgcccgtgccggcttccatggataccatgg
atattcggagggcggccgcagaggcagctgaggggtttaggccggtggagtttggtggagtgtgcagcggcagcagtgat
gagaaggagagaatggtggtgcaggtggaagagaagaacaagaagggtagtgtgaacttggaaagaagcagaagcttgag
cttgtcctattgggatgaggaggaagtgtttcacatgcccaggttgcttcatgacatggctgaagggcttcttctttctc
catcgcaatgcttaggtggctacatgaatttggatgacatgggcaccgatgctgatgtcaaattgtggagtttctccatt
taa
back to top
>AB080965.1-DREB1L699
atggacatgatctacagccagctctctgatttagcttctatggaaaacccggatacgtcttcgttttcggacgccagcgt
tacggcccggcgagcttctctttcagatgaggaggtcatactggcgtccagctgcccgaaaaggcgggcggggaggaggg
ttttcaaggagaccaggcacccggtttataggggtgtgaggaggaggaacaacaacaagtgggtgtgtgagctgagagcc
cccaacaacaagaaggccaggatatggctcgggacttatccgacggctgagatggcggctcgtgcccatgatgtcgctgt
attggcgtttagggggaagcttgcctgcctcaactttgctgactcggcttggcggctgcctgtgcctgcctccaccgatg
ccgcggagattaggagggcggccaccgaggccgctgaagcgtttaggcaggcggaggatggtggtgttgatgagaaggag
agtaaggcagtggtgagtgaggagaagggttgtgtaggaatggagggaagcagcaacttgttttatttggacgaggacga
aatatttgagatgccaaggttgcttgatgacatggctgatgggattatgctttgtccacctcaatgcttagatggctaca
tggattggaatgacgtggaaactgttgacgatttgaaactgtggagtttttctatttga
back to top
>AB080967.1-DREB1L.m1390
atggacgtgtctcaactttccgactcggtcgaccagcccgagtcgagttctttgtccgacgtcagcttcaagactcgggg
gccttcttggtccgacggggaagtcatattggcgtcaagccggccgaagaagcgagccgggaggagggttttcaaggaga
cgaggcaccccgtttataggggtgtgaggaggaggaacaatgacaagtgggtttgtgaaatgagagagcccaacaacaag
aagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggccgcattggcgtttag
agggaagcttgcctgcctcaactttgctgactccgcgtggaggctgcccgtgccggcttccatggatcga
back to top
>AB080966.1-DREB1L.m1723
atggacatgttcttctctcaactttcagactcggtcgaccagccccagtcgagtttgttgtccgacgccagcgtcaccac
tcgaggggcttcttgttccgacggggacgtcatattggcgtcgagccggccgaagaagcgagcggggaggagggttttca
aggagacgaggcacccggtttataggggtgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaac
aagaagaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggccgcattggc
gtttagagggaagcttgcatgcatcaactttgctgactcagcgtggaggctgcccgtgccggcttccatggataccatgg
atattcggagggcggccgcagaggcagctgaggggtttaggccggtggagtttggtggagtgtgcagcggcagcagtgat
gagaaggagagaatggtggtgcaggtggaagagaagaacaagaagggtagtgtgaacttggaaagaagcagaagcttgag
cttgtcctattgggatgaggaggaagtgtttcacatgcccaggttgcttcatgacatggctgaagggcttcttctttctc
catcgcaatgcttaggtggctacatgaatttggatgacatgggcaccgatgctgatgtcaaattgtggagtttctccatt
taa
back to top
>AB080965.1-DREB1L.m1699
atggacatgatctacagccagctctctgatttagcttctatggaaaacccggatacgtcttcgttttcggacgccagcgt
tacggcccggcgagcttctctttcagatgaggaggtcatactggcgtccagctgcccgaaaaggcgggcggggaggaggg
ttttcaaggagaccaggcacccggtttataggggtgtgaggaggaggaacaacaacaagtgggtgtgtgagctgagagcc
cccaacaacaagaaggccaggatatggctcgggacttatccgacggctgagatggcggctcgtgcccatgatgtcgctgt
attggcgtttagggggaagcttgcctgcctcaactttgctgactcggcttggcggctgcctgtgcctgcctccaccgatg
ccgcggagattaggagggcggccaccgaggccgctgaagcgtttaggcaggcggaggatggtggtgttgatgagaaggag
agtaaggcagtggtgagtgaggagaagggttgtgtaggaatggagggaagcagcaacttgttttatttggacgaggacga
aatatttgagatgccaaggttgcttgatgacatggctgatgggattatgctttgtccacctcaatgcttagatggctaca
tggattggaatgacgtggaaactgttgacgatttgaaactgtggagtttttctatttga
back to top