DREB1, DREB1 (gene) Prunus avium

Gene Overview
Name DREB1
Gene Symbol DREB1
Type gene
Organism Prunus avium
Synonym dehydration responsive element binding protein 1
Description NA
Comment C-repeat binding factor; CBF
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBPrunus aviumgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB1AB121674.1-DREB1.m1Prunus aviummRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB121674.1-DREB1.m1 N/A AB121674.1

Sequence(s):
>AB121674.1-DREB1.m1723
atggacatgttcttctctcaactttcagactcggtcgaccagccccagtcgagtttgttgtccgacgccagcgtcaccac
tcgaggggcttcttgttccgacggggacgtcatattggcgtcgagccggccgaagaagcgagcggggaggagggttttca
aggagacgaggcacccggtttataggggtgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaac
aagaagaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggccgcattggc
gtttagagggaagcttgcatgcatcaactttgctgactcagcgtggaggctgcccgtgccggcttccatggataccatgg
atattcggagggcggccgcagaggcagctgaggggtttaggccggtggagtttggtggagtgtgcagcggcagcagtgat
gagaaggagagaatggtggtgcaggtggaagagaagaacaagaagggtagtgtgaacttggaaagaagcagaagcttgag
cttgtcctattgggatgaggaggaagtgtttcacatgcccaggttgcttcatgacatggctgaagggcttcttctttctc
catcgcaatgcttaggtggctacatgaatttggatgacatgggcaccgatgctgatgtcaaattgtggagtttctccatt
taa
back to top