DREB2-4, DREB2-4 (gene) Malus x domestica

Gene Overview
Name DREB2-4
Gene Symbol DREB2-4
Type gene
Organism Malus x domestica
Synonym dehydration-responsive element-binding protein (DREB2)
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB2-4JQ669819.1-DREB2-4.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ669819.1-DREB2-4.m1 Chr04:25592875..25596077
chr4:16514922..16518124
chr4:18683819..18687021
JQ669819.1

Sequence(s):
>JQ669819.1-DREB2-4.m11476
atggagtccgaggcttcggacggggaaaggaaattgcggaagaggcgcaacgggtgcgaatcgatagaggacacactgac
caagtggaagaactacaatgagaggcttgattctgggaaagatggagggaagaagactcgggctccggcgaagggctcca
gaaaaggctgcatgagggggaaaggagggccggagaactcagattgtgtatttaggggtgttaggcagaggacttgggga
aaatgggtggcggaaattcgagaaccaattcgagctagagccggttctgtacctacgaagaagaataggcgtctttggct
tggtactttccctacagcctatgaagctgctcttgcttatgataaagctgctagagcaatttatggtgctttggcccggc
tcaacttccccgacaatgctgtggactcgaaggactactactctaattctgtgtcatctaaaacaccatcgtcgcatgag
tcctcattgacatacaataatgcggatgaggcagggggaagatcaggattctttgaggattgtgtggccaaagagcaaaa
gcaggaaacggattgttctgtatcagaggaattacatgttttacgtgctacctcaagagaaccaaaagctgtgaaatgtg
aatacgaaactgaacgtgagcttgttaagaacgatgatgtttttcagaccgagagctatggaagcttcgatcatagggga
gattacttgcctaatgagcccctggttgtgaattttgatacggtatttgattgtaagccttgtaacgatatggatccttt
ggagaaacttttgaggtccaattatgattacttaactgagcttgtagatggggaatgcaatcggagaaacagttgcaagc
cttcaaatgatgtcaaagttgagacaccggcaatgagggaagccgcggagaaaccatttccggtgattctggaatccgga
agtcacaacgggttagatgagaagtacaacaacatacatggtgagcaaataaacgcggccgaaattcttgtaaccaattt
tgagccttctgaggatgttgaaatgaagttatcgatgacgaatcaagaattgcaaggaggatttgcagaaacaacgagat
tagatggccataattgcaatggcttcatacatagttatgcttgtttagatgatttagatgtggcatacggtccgagatat
ggcattaatccttggaatgatatcggaatgcagacagagctcgacgacagacttgactacgtgcataactggtctgcaga
ggaaacctatggcattgatgctgctgaggaccaacaatgggggaggacgcataatctccctattcagttgcagacacaac
cacatcccgacatacctggaagctcgaatcacacggagtacgcacatttaggcgtggatatcgatcgacaaagttacgat
tctggtgcaatggaagagcaggggctgcctaaatga
back to top