DREB2, DREB2 (gene) Malus prunifolia

Gene Overview
Name DREB2
Gene Symbol DREB2
Type gene
Organism Malus prunifolia
Synonym dehydration-responsive element binding protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB2JN204427.1-DREB2.m1Malus prunifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus prunifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JN204427.1-DREB2.m1 Chr12:7986304..7987162
chr12:6886608..6887466
chr12:6872821..6873679
chr12:8236489..8237347
JN204427.1

Sequence(s):
>JN204427.1-DREB2.m1858
atggataacagcagaaaatctccgttgaagccttggaagaaaggcccgacgagaggcaaaggcggccctcagaacgcctc
ctgcgaataccgcggcgttcggcaaagaacttggggcaaatgggtggctgaaatcagagagcctaagaagagaaccaggc
tgtggctgggctcttttgctacggctgaggaagctgccatggcctatgacgatgctgccaggagactctacggccccgaa
gcttttctcaaccttcctcaccttcaacccagctccaatccttcactcaaatctcaaaaattcaagtggttcccttccca
caacttcatttccatgtttccttcgtgcggtttgctcaacatcaatgcgcagccgagcgttcatgtcattcatcagaggc
tccaagaacttaagcaaaatggggttcttggtcacaccaccccttcctctagttcttcctcctgtgattcaaaatctgag
gctcacatcctgagtgacaaaaccgagatgcgaaatgttgcagagaaggagaaggatgtcgaaatttcatctgaaaaaga
ggcggaagactaccaggagaagccacagatggatctcaatgagtttcttcagcaactgggagtactgaacaaggagacac
aatcagaggcaactgagacaacagaaagttttacagctccggaattttcgatcggagaagttcatgatgaattcggaccc
tttgctgacaagaatatcaattgggatgcattgattgagatgcacgggatttcaaaccaaggagcagatgctggtacctt
tcaagtttacgatatgaatgaagagccttccttccccacttccatttggaacttctaa
back to top