DREB2, DREB2 (gene) Malus sieversii

Gene Overview
Name DREB2
Gene Symbol DREB2
Type gene
Organism Malus sieversii
Synonym DREB2
DREB2 transcription factor
Description NA
Comment MsDREB2; transcription factor
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB2JQ790526.1-DREB2.m1Malus sieversiimRNA
DREB2JQ086364.1-DREB2.m1Malus sieversiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus sieversiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ790526.1-DREB2.m1 Chr01:26531656..26532853
chr1:21459655..21460852
chr1:21458392..21459589
JQ790526.1
predicted genes from whole genome assembly JQ086364.1-DREB2.m1 Chr01:26531656..26532853
JQ086364.1

Sequence(s):
>JQ790526.1-DREB2.m11197
atgggagcttatgatcaaggcgctaacatgtcatctctgcccttggattcttcaaggaagaggaagacgcggagcaggcg
agatgggaactctgttgctgagacactagaaaagtggaaagagtataataagaaactggaatcggttaataacgagggga
aaacgcgtaaagtgcccgccaaggggtcgaagaaaggctgtatgaaaggcaagggagggcctgagaatgcacgttgcaat
tacagaggtgtgaggcaaaggacttggggcaagtgggtcgccgagattcgggagccagacaggggaagcaggctttggtt
gggtacttttcccactgcccttgatgctgcccttgcgtatgatgaggctgcgaaggccatgtatggtactggtgctcgcc
tcaacctcccgcatgcggccaattatcatccatcgtcttcactggagacttcttcagttgcaacaccatcagggtcttct
gcagtggcaactccaggatgctctacttccacttcaacctcaagtcgctctgagatttgtggagacgaggattccaagct
ttttcttaatgtgaaaaaggaggatggtgagggcgaatcaaggatgtatccgtggtctactgcggtccctcaagccagtg
gtatggttaagccagaaatcattgaggatttcactatggattatcttcgtaataatcaacaacaacctgtcgtcaaaccg
gaagcaggagttgaggatcataattggaatggcggagaaggttttattggggattattcagagaacttcacaaccgacga
gttgtttgatatggatgagatgtttgatgtaaatgaactgttgatgccttcagatgatatttccctttgcaattcaggat
cggagcaagtttggagagctgacgttggtcagtcgggcatggagactctcagcagtgagaggccatcaaatttatcgtac
cagctgcagtttccagacgccaagctgctcgggagtctgcagcacatggagcatgccccattgaacttcgaatacggttt
tgatttcaagaagcaagaaaaggaggggagtaatcataccggccaagatgatcaagggtacttcaatctgggattgtctg
acttagatttggaaggattcacaggaggaataacacaatccggagatggaggttacaactattcgatggaaatgtga
back to top
>JQ086364.1-DREB2.m11197
atgggagcttatgatcaaggcgctaacatgtcatctctgcccttggattcttcaaggaagaggaagacgcggagcaggcg
agatgggaactctgttgctgagacactagaaaagtggaaagagtataataagaaactggaatcagttaataacgagggga
aaacgcgtaaagtgcccgccaaggggtcgaagaaaggctgtatgaaaggcaagggagggcctgagaatgcacgttgcaat
tacagaggtgtgaggcaaaggacttggggcaagtgggtcgccgagattcgggagccagacaggggaagcaggctttggtt
gggtacttttcccactgcccttgatgctgcccttgcgtatgatgaggctgcgaaggccatgtatggtactggtgctcgcc
tcaacctcccgcatgcggccaattatcatccatcgtcttcactggagacttcttcagttgcaacaccatcagggtcttct
gcagtggcaactccaggatgctctacttccacttcaacctcaagtcgctctgagatttgtggagacgaggattccaagct
ttttcttaatgtgaaaaaggaggatggtgagggcgaatcaaggatgtatccgtggtctactgcggtccctcaagccagtg
gtatggttaagccagaaatcattgaggatttcactatggattatcttcgtaataatcaacaacaacctgtcgtcaaaccg
gaagcaggagttgaggatcataattggaatggcggagaaggttttattggggattattcagagaacttcacaaccgacga
gttgtttgatatggatgagatgtttgatgtaaatgaactgttgatgccttcagatgatatttccctttgcaattcaggat
cggagcaagtttggagagctgacgttggtcagtcgggcatggagactctcagcagtgagaggccatcaaatttatcgtac
cagctgcagtttccagacgccaagctgctcgggagtctgcagcacatggagcatgccccattgaacttcgaatacggttt
tgatttcaagaagcaagaaaaggaggggagtaatcataccggccaagatgatcaagggtacttcaatctgggattgtctg
acttagatttggaaggattcacaggaggaataacacaatccggagatggaggttacaactattcgatggaaatgtga
back to top