DREB5-1, DREB5-1 (gene) Malus x domestica

Gene Overview
Name DREB5-1
Gene Symbol DREB5-1
Type gene
Organism Malus x domestica
Synonym dehydration-responsive element-binding protein (DREB5)
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB5-1JQ669820.1-DREB5-1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ669820.1-DREB5-1.m1 Chr15:49614192..49614798
chr15:40717681..40718287
chr15:40717623..40718229
chr15:40726294..40726900
chr15:47453781..47454387
chr15:47445110..47445716
JQ669820.1

Sequence(s):
>JQ669820.1-DREB5-1.m1606
atggaatcccaggctgcagactgccgcgtctctccggcaagatacaaaggagttcgcaagcgaaaatggggcaaatgggt
gtccgaaatccgcgaaccaggaaagaaaaccagaatatggctaggaagctacgaggcaccagaaatggcagctgcggcct
atgatgcagcggcattgcacctcaaagggtgtggggcggcgcttaattttcctgaaatggctgatagtcttccgaggccg
gccagttcaagcgcaatggacgtgcaactagcggctcaagaggctgcattgagggttagacgacagcagctgccaatgga
ggcatttccaaaggaggaggtgggtggctcgtcgaggggtttgagctcagcgccagtgacggtgggactgtctccgagtc
aaatccaggcgattaatgagtcgccgttggactcgccaaagatgtggatgcagtacatgtgcagggctcattgccatgag
gctccgtcgtcgttagggggagacctgtgggacactgataattccagtccaaacaagtactatgaaggtgatgtcgagtc
aatggactacgaagatatgcagcattggtccatttgggatccctag
back to top