DREBA5, DREBA5 (gene) Malus sieversii

Gene Overview
Name DREBA5
Gene Symbol DREBA5
Type gene
Organism Malus sieversii
Synonym dehydration-responsive element binding protein
Description NA
Comment MsDREBA5
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREBA5JQ655768.1-DREBA5.m1Malus sieversiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus sieversiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ655768.1-DREBA5.m1 Chr15:5382755..5383238
chr15:2216555..2217038
chr15:2216556..2217039
JQ655768.1

Sequence(s):
>JQ655768.1-DREBA5.m1483
atggaaggcgattactgctgctcttcgtcgtcttcttcctcaacgtccacgagcatggagaagcgtaagcatcctgatca
ccgccaagaaaagcaatacagaggaatacggatgaggaagtgggggaagtgggtggcggagattcgagaacccaacaagc
gctctcgaatttggctcggctcctacacgacccccatggctgccgcccgagcttacgacaccgccgttttctatcttcga
ggcccttctgcccgcctcaacttcccggaacttgtattccaagacgacggccagcagctccacgacatgtcggcggcttc
gatacggaagaaagctacggaggtcggggctaaggtcgacgctgttcaaaccgctctccgctcatcgccgacgtcgcagt
ccaaaacaacgttgagccggggtggctctttgaagcccgacttaaatgagtaccccgacccagaaaactccgatgaaagt
taa
back to top