DREB, DREB (gene) Prunus persica

Gene Overview
Name DREB
Gene Symbol DREB
Type gene
Organism Prunus persica
Synonym dehydration responsive element binding protein
Description NA
Comment PpDREB; DREB transcription factor; induced by dehydration stress
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREBEF635424.1-DREB.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF635424.1-DREB.m1 scaffold_5:10054607..10055300
EF635424.1

Sequence(s):
>EF635424.1-DREB.m1693
atggacatgttctccgctcagctttctgactcccccgaccagcctgagtcgagttctttctccgacgccagcgtcaccac
cctgccggcatcttcctccgacgaaaacgtcatattggcgtcgagccggccgaagaagcgcgctgggaggagggttttca
aggagacgaggcacccggtttacaggggcgtgaggagaaggaacaacaacaagtgggtatgtgagttgagagaacccaac
aacaagaagtcaaggatttggcttggaacgtatccgacggctgagatggctgctcgtgcccatgacgtggcggcattggc
gttcagagggaagcttgcctgcataaactttgctgactccgcatggcggctgcccttgccggcttccatggacaccatgg
atattcgaagggcagccgctgaggccgccgaagggttcaggcctgcggagttcggtggattatccagcggcagcagtgat
gagaaggagatgaatttaagcgtggatatggaaaaaaacagcagcttgtgcttgttttatttggatgaggaggaaatgtt
tgatatgccaaggttgattgataacatggctcaagggcttcttctttctccacctcaatgctcagctggctacttgaatt
gggatgacgtggaaactgaagctgatgccaaattatggagtttctctatctga
back to top