EBF1, EBF1 (gene) Malus x domestica

Gene Overview
Name EBF1
Gene Symbol EBF1
Type gene
Organism Malus x domestica
Synonym EIN3 binding F-box 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
EBF1JX512439.1-EBF1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
EIN3-binding F-box proteinEBFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JX512439.1-EBF1.m1 Chr08:15213235..15215841
chr8:18667673..18670286
chr8:18663310..18665922
chr8:22030220..22032137
JX512439.1

Sequence(s):
>JX512439.1-EBF1.m11941
atgtcaaagctacttggcttctccggtaaagatgatttttgccctgggggaatatacacaaaccctaaagaagctggcct
cttgttgtctcttggacatcatgctgatgtcctatttcctcctcgcaagaggtctcgcatcagcgcccccttcattttta
gcggaggatattttgagaaggaggtgtctataaatgttctaccagatgagtgcctctttgaaatctttaaacggattcct
ggaggcgaggaaaggagtgcttgtgcatgcgtttccaagcggtggcttaatgttttaagtaatatcaatagggatgaatt
cagcagcaacacaaccaaccaatctttcaagtctcaggatgaggtctctggaaataaagctgaagatcaggaagttgagg
gttgtggatatctttccaggagcttggaaggaaagaaggcaacagatgttagacttgctgcaattgctgttggaactgct
agtcgtggtggattgggaaagcttatgatccgtggaaacaattctgttcgtggggtgacaaaccttggccttaaggcaat
atcccatggctgtccttctctgagggttctttctttgtggaacatgtcctctattggagatgagggcctgtgcgagattg
ctaaccgctgtcatctgttagagaagcttgacctctcccggtgtcctgcaatatctgataagggtttgattgcaattgcc
aagaagtgtcctaatttgacagatgtatcacttgagtcttgttccaacattggaaatgaaggtcttcaagcaattggcca
gtgctgccccaatctcaaatccatttcaatcaagaattgccatcttgttggggatcagggaattgttagtttgctatctt
caatctcttatgtcctgacaaaggtgaagcttcaggctttgaccatctctgatgtgtctcttgccgttattggacactat
ggcaatgctgtaacggatcttgtccttaccagcctctctaacgtgactgagaggggtttctgggtcatgggcaatggtca
gggactgcagaagttgaagtccttcactgttacatcctgtcaaggtgttacagatacaggtcttgaagcagtaggaaaag
gttgcccgaacttgaaacagttttgccttcgcaaatgtctattcgtatctgacagtgggttggtatcgttctgcaaagca
gcaggatctcttgagagccttcatttagaggagtgccacaggatcacccaatttgggctttttggtgttctttcaactgg
tggttcaaaattgaagtctctggcttttgtttcctgcctgggattgaaggatctaaactttggatcacctggggtgtctc
cgtgccaatctcttcaatcattgtcgattcgtagctgccctggatttgggaacgttggcctggctcttttgggtaaactt
tgccctcaactgcagcatgtagacttcagtggtcttgagagtataacagatgttgggtttctcccactggttgagaactg
tgaggctggcctggtaaaggttaatctcagcggttgtgtgaatctaacagacaaagtggtttcatccatggctgacctac
atggttggactatggaagtcctaaaccttgaaggctgtagactggtcagcgatgcaggcttggcagctattgcagggaac
tgcacattgcttagtgatcttgacgtctcaaggtgtgcaatcaccaattttggaattgcatccctagcccatgcagacca
gctaaatctgcagatgctctccatatctgggtgccctttggtatctgacaagagtttgcctgccttggtgaaaatgggtc
agacccttcttggtttgaatcttcagcattgcaacgcaatcagcagcagcactgttgaccggctcgtggagcagctgtgg
cgttgtgatatcctttcctag
back to top