EH2, EH2 (gene) Prunus persica

Gene Overview
Name EH2
Gene Symbol EH2
Type gene
Organism Prunus persica
Synonym epoxide hydrolase 2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
EH2FN430417.1-EH2.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
epoxide hydrolaseEHPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FN430417.1-EH2.m1 scaffold_8:21406986..21409021
FN430417.1

Sequence(s):
>FN430417.1-EH2.m1951
atggagaaaattgagcacacaacggtaagcacaaacggcataaacatgcacatagcgtcaatcggtacaggcccagttgt
gctcttcctccatggattcccggagctctggtactcatggcgccaccagctcctttctctctcatccttgggctaccgtt
gcatagcccctgacctccgaggcttcggtgacaccgacgcaccaccttcccctgcctcctactcggccctgcacatagtt
ggtgacctcattggcctccttgaccatctgggtattgaccaagtcttcttggtcggccatgactggggcgccgtcattgc
ctggtggttctgcttgttcaggcctgaccgagtcaaggccttggtcaacatgagtgtggccttcagtcccaggaacccaa
agagaaagcctgtcgatggtttcagggccttgttcggtgatgattactatatttgcaggttccaggaacctggggagatc
gaaaaagaatttgctggttatgatactacatcaataatgaaaaagtttcttactggtcgtagtccaaaacctccatgcct
acctaaagaactaggattaagagcttggaaaactccagaaaccttgcccccttggctgtcagaagaggaccttaattatt
ttgccagcaaattcagcaagacggggtttgttggtggattgaactattatcgagctttgaacttaacctgggagcttaca
ggaccatggacagggctacaggtcaaagtaccggtcaagtttattgtgggcgacctggacatcacctatcatatcccagg
cgtgaagaactatatacataatggaggcttcaaaagagatgtgccatttttgcaagaggtggttgtgattgaagatggag
ctcactttattaaccaggaaaggcccgacgaaatcagtcggcacgtatatgacttcatccagaagttctga
back to top