F3H, F3H (gene) Fragaria chiloensis

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Fragaria chiloensis
Synonym flavonoid 3'-hydroxylase
flavanone-3-hydroxylase
Description NA
Comment F3H
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HHM854010.1-F3H.m1Fragaria chiloensismRNA
F3HHM026183.1-F3H.m1Fragaria chiloensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HFragaria chiloensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM854010.1-F3H.m1 N/A HM854010.1
mRNA parsed from NCBI nr database HM026183.1-F3H.m1 LG1:7929791..7930775
HM026183.1

Sequence(s):
>HM854010.1-F3H.m11539
atgtttctcatagcagcgatcacccttctcgtcgccctggttttgttccggcttcttttctccggcaaatcccaacgtcg
ctcgcttcctctccctcctggccccaaaccatggcccgtggttggaaacctgcctcacttgggcgtttttccgcaccact
ctctcgcggatttggcgcggaaacacggcccgctcatgcacctccgcctcggttacgttgacgtagtcgtggcggcatca
gcatccgtagcgtctcagttcttaaagactcacgacgccaacttctccagccggccacccaactccggcgccaagtacat
ggcttacaactaccaggaccttgtgttcaggccctacggtcctcggtggcgccagttccggaagatcagctccgtccatc
tgttctccggcaaggccttggatgatcttaaacacgtccggcaggaggaggtagctgtgctagcgcatgccttagcaaat
gcagggtcaaaggcagtgaatctggcgcaactgctcaacttgtgcacggccaacgccctagggcgagtgatggtagggcg
gagggtttttggcgacggcagcggcagcgacgatccaaaggcggacgagttcaaatcgatggtggtggagatgatggtat
tggcaggagtgcccaacataggtgacttcattccctgccttgagtggcttgacttgcaaggcgtggtgtccaagatgaag
aagctccacaagagattcgacgactttttgacggccattgtcgaggaccacaagaaaagcacgggcacggcggcgcacgt
cgacatgttgaccaccctgctctccctccaggaagatgccgacggcgaaggtgccaagctcaccgacaccgagatcaagg
ctttgcttttgaacatgttcacagctggcactgatacgtcatcgagcactgtggaatgggcattggctgaacttattaag
caccctcgtatgttagcgcgagtccaaaaagagctggacgatgttgttggacatgaccgactcgtgacagaattggatct
acccaacctcacctacctccaagccgttatcaaagagacgttccggcttcacccgtccactcctctctcattgcctcgta
tggcggccgagagttgtgaaatcaacggctaccacatcccgaagggttccacattgttggtcaatgtatgggccatttcg
cgtgacccggctgaatgggccgaaccattagagtttaggcccgaaagattcttaccgggcggcgaaaagcctaacgttga
tataagaggaaatgattttgaagtcatacccttcggtgctgggagaagaatatgtgctgggatgagcttgggcctccgta
tggtcagtttgatgactgcaacattggtccatgcgtttgattggaccttggcggatgggacacctgagaagttaaacatg
gatgaagcatttgggctcactctacaacgagctgcaccgttaatggtgcacccgcgcacccggctagccccacatgctta
taaaacttcatcatcttaa
back to top
>HM026183.1-F3H.m1478
cggtgcaggattggcgcgagattgtgacctacttctcatacccggtgcgccaccgtgactactcgaggtggtcggacaag
cccgaggggtggagagatgtgacaacgcagtacagtgacgagctgatggggttggcatgcaagctattggaggttttatc
agaggccatgggtttagagaaggaggcattgacaaaggcatgtgtggacatggaccaaaaggttgtggtgaatttctacc
cgaaatgcccccagccggacctcactctcggactcaaacgccacacggatcccggtaccattacccttttgctgcaggac
caagtcggtggacttcaggccaccagggacggcggaaagacgtggatcaccgttcaacctgtggaaggagctttcgtggt
gaatcttggagaccatggacattttctgagcaatgggaggttcaagaatgctgatcaccaggcggtggtgaactcaaa
back to top