F3H, F3H (gene) Fragaria vesca

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Fragaria vesca
Synonym flavonoid 3'-hydroxylase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HKC708488.1-F3H.m1Fragaria vescamRNA
F3HHM854006.1-F3H.m1Fragaria vescamRNA
F3HHM854005.1-F3H.m1Fragaria vescamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HFragaria vescagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KC708488.1-F3H.m1 LG5:7611688..7614828
KC708488.1
mRNA parsed from NCBI nr database HM854006.1-F3H.m1 LG5:7611688..7614828
HM854006.1
mRNA parsed from NCBI nr database HM854005.1-F3H.m1 LG5:7611688..7614828
HM854005.1

Sequence(s):
>KC708488.1-F3H.m11539
atgtttctcatagcagcgatcacccttctcgtcgccgtggttctattccggcttcttttctccggcaaatcccaacgtcg
ctcgcttcctctccctcctggccccaaaccatggcctgtcgtcgggaacttgcctcacttgggcccttttccgcaccact
ctctggcggagttggcgcagaaacacgggcccctcatgcacctccgcctcggttatgttgacgtagtggtggcggcatca
gcatccgtagcgtctcagttcttgaagactcacgacgctaacttctccagccggccacccaactccggcgccaagtacat
ggcctacaactaccaggacctcgtgttcaggccctacagtccacggtggcgccagttccggaagatcagctccgtccatc
ttttctccggcaaggccttggatgaccttaaacacgtccggcaggaggaggtagctgtgctagcgcatgccttagcaaat
gcagggtcaaaggtagtgaacctggcgcaactactcaacttgtgcacggtcaacgccctagggcgagtgatggtagggcg
gagggttttcggcgacggcagcggcagcgacgatccgaaggcggacgagttcaagtcaatggtggtggagatgatggtgt
tggcaggagtgcccaacataggtgacttcattccctgccttgagtggcttgacttgcaaggtgtggcgtccaagatgaag
aagctccacaagagattcgacgacttcttgatggccattgtcgaggatcacaagaagagcaccggcacggcggcgcacgt
cgacatgttgaccactctgctctccctccaggaagacgccgacggcgaaggtgccaagctcaccgacaccgagatcaagg
ctttgcttttgaacatgttcacagctggcactgatacgtcatcgagcacggtagaatgggcattggccgaacttattaag
caccctcatatgttagcgcgactccgaaaagagttggacgatgttgttggacatgaccgactcgtgacagaaccggacct
acccaagctcacctacctccaggccgttatcaaggagacgttccggcttcacccgtccactcctctctcattgcctcgta
tggcggccgagagttgtgaaatcaacgggttccacatcccgaagggttccacattgttagtcaatgtatgggccatatcg
cgtgacccggctgaatgggccgaaccgttggagttcaggcccgaaaggtttttaccgggcggcgaaaagcctaatgttga
tattagaggaaatgattttgaagtcataccctttggtgctgggagaagaatatgtgctgggatgagcttgggcctccgta
tggttagtttgatgactgcaacattggtccatgcgtttgattggaccttggctgatgggacacctgagaagttaaacatg
gatgaagcatttgggctcactctacaacgagctgcaccgttaatgatgcacccgcgcacccggctagccccacatgctta
taaaacttcatcatcttaa
back to top
>HM854006.1-F3H.m11539
atgtttctcatagcagcgatcacccttctcgtcgccgtggttctattccggcttcttttctccggcaaatcccaacgtcg
ctcgcttcctctccctcctggccccaaaccatggcctgtcgtcgggaacttgcctcacttgggcccttttccgcaccact
ctctggcggagttggcgcagaaacacgggcccctcatgcacctccgcctcggttatgttgacgtagtggtggcggcatca
gcatccgtagcgtctcagttcttgaagactcacgacgctaacttctccagccggccacccaactccggcgccaagtacat
ggcctacaactaccaggacctcgtgttcaggccctacagtccacggtggcgccagttccggaagatcagctccgtccatc
ttttctccggcaaggccttggatgaccttaaacacgtccggcaggaggaggtagctgtgctagcgcatgccttagcaaat
gcagggtcaaaggtagtgaacctggcgcaactactcaacttgtgcacggtcaacgccctagggcgagtgatggtagggcg
gagggttttcggcgacggcagcggcagcgacgatccgaaggcggacgagttcaagtcaatggtggtggagatgatggtgt
tggcaggagtgcccaacataggtgacttcattccctgccttgagtggcttgacttgcaaggtgtggcgtccaagatgaag
aagctccacaagagattcgacgacttcttgatggccattgtcgaggatcacaagaagagcaccggcacggcggcgcacgt
cgacatgttgaccactctgctctccctccaggaagacgccgacggcgaaggtgccaagctcaccgacaccgagatcaagg
ctttgcttttgaacatgttcacagctggcactgatacgtcatcgagcacggtagaatgggcattggccgaacttattaag
caccctcatatgttagcgcgactccgaaaagagttggacgatgttgttggacatgaccgactcgtgacagaaccggacct
acccaagctcacctacctccaggccgttatcaaggagacgttccggcttcacccgtccactcctctctcattgcctcgta
tggcggccgagagttgtgaaatcaacgggttccacatcccgaagggttccacattgttagtcaatgtatgggccatatcg
cgtgacccggctgaatgggccgaaccgttggagttcaggcccgaaaggttcttaccgggcggcgaaaagcctaatgttga
tattagaggaaatgattttgaagtcataccctttggtgctgggagaagaatatgtgctgggatgagcttgggcctccgta
tggttagtttgatgactgcaacattggtccatgcgtttgattggaccttggctgatgggacacctgagaagttaaacatg
gatgaagcatttgggctcactctacaacgagctgcaccgttaatgatgcacccgcgcacccggctagccccacatgctta
taaaacttcatcatcttaa
back to top
>HM854005.1-F3H.m11539
atgtttctcatagcagcgatcacccttctcgtcgccgtggttctattccggcttcttttctccggcaaaccccaacgtcg
ctcgcttcctctccctcctggccccaaaccatggcctgtcgtcgggaacttgcctcacttgggcccttttccgcaccact
ctctggcggagttggcgcagaaacacgggcccctcatgcacctccgcctcggttatgttgacgtagtggtggcggcatca
gcatccgtagcgtctcagttcttgaagactcacgacgctaacttctccagccggccacccaactccggcgccaagtacat
ggcctacaactaccaggacctcgtgttcaggccctacagtccacggtggcgccagttccggaagatcagctccgtccatc
ttttctccggcaaggccttggatgaccttaaacacgtccggcaggaggaggtagctgtgctagcgcatgccttagcaaat
gcagggtcaaaggtagtgaacctggcgcaactactcaacttgtgcacggtcaacgccctagggcgagtgatggtagggcg
gagggttttcggcgacggcagcggcagcgacgatccgaaggcggacgagttcaagtcaatggtggtggagatgatggtgt
tggcaggagtgcccaacataggtgacttcattccctgccttgagtggcttgacttgcaaggtgtggcgtccaagatgaag
aagctccacaagagattcgacgacttcttgatggccattgtcgaggatcacaagaagagcaccagcacggcggcgcacgt
cggcatgttgaccactctgctctccctccaggaagacgccgacggcgaaggtgccaagctcaccgacaccgagatcaagg
ctttgcttttgaacatgttcacagctggcactgatacgtcatcgagcacggtagaatgggcattggccgaacttattaag
caccctcatatgttagcgcgactccgaaaagagttggatgatgttgttggacatgatcgactcgtgacagaaccggacct
acccaagctcacctacctccaggccgttatcaaggagacgttccggcttcacccgtccactcctctctcattgcctcgta
tggcggccgagagttgtgaaatcaacgggtaccacatcccgaagggttccacattgttagtcaatgtatgggccatatcg
cgtgacccggctgaatgggccgaaccgttggagtttaggcctgaaaggttcttaccgggcggcgaaaagcctaatgtcga
tattagaggaaatgattttgaagtcataccctttggtgctgggagaagaatatgtgctgggatgagcttgggcctccgta
tggttagtttgatgactgcaacattggtccatgcgtttgattggaccttggctgatgggacacctgagaagttaaacatg
gatgaagcatttgggctcactctacaacgagctgcaccgttaatgatgcacccgcgcacccggctagccccacatgctta
taaaacttcatcatcttaa
back to top