F3H, F3H (gene) Fragaria vesca subsp. bracteata

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Fragaria vesca subsp. bracteata
Synonym flavanone 3-hydroxylase
Description NA
Comment F3H
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HFragaria vesca subsp. bracteatagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HAY017482.1-F3H.m1Fragaria vesca subsp. bracteatamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY017482.1-F3H.m1 N/A AY017482.1

Sequence(s):
>AY017482.1-F3H.m1113
tggattaccgttcaacctgtggaaggacctttcgtggtgaatcttggagaccatggacattttctgagcaatgggaggtt
caagaatgctgatcaccaggcagtagtgaactc
back to top