F3H, F3H (gene) Fragaria x ananassa

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Fragaria x ananassa
Synonym flavonoid 3'-hydroxylase
flavonoid 3' hydroxylase
flavanone 3-hydroxylase
FHT
FrF3H1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HAY691919.1-F3HFragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HKC708489.1-F3H.m1Fragaria x ananassamRNA
F3HHM854008.1-F3H.m1Fragaria x ananassamRNA
F3HHM854007.1-F3H.m1Fragaria x ananassamRNA
F3HAB665441.1-F3H.m1Fragaria x ananassamRNA
F3HFJ469980.1-F3H.m1Fragaria x ananassamRNA
F3HAY679608.1-F3H.m1Fragaria x ananassamRNA
F3HAY691919.1-F3H.m1Fragaria x ananassamRNA
F3HAY691918.1-F3H.m1Fragaria x ananassamRNA
F3HAB201760.1-F3H.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY691919.1-F3H LG1:7929525..7931742
AY691919.1
mRNA parsed from NCBI nr database KC708489.1-F3H.m1 N/A KC708489.1
mRNA parsed from NCBI nr database HM854008.1-F3H.m1 LG5:7611688..7614822
HM854008.1
mRNA parsed from NCBI nr database HM854007.1-F3H.m1 LG5:7611688..7614822
HM854007.1
mRNA parsed from NCBI nr database AB665441.1-F3H.m1 N/A AB665441.1
mRNA parsed from NCBI nr database FJ469980.1-F3H.m1 N/A FJ469980.1
mRNA parsed from NCBI nr database AY679608.1-F3H.m1 LG1:7929553..7930443
AY679608.1
mRNA parsed from NCBI nr database AY691919.1-F3H.m1 LG1:7929547..7931288
AY691919.1
mRNA parsed from NCBI nr database AY691918.1-F3H.m1 LG1:7929547..7931288
AY691918.1
mRNA parsed from NCBI nr database AB201760.1-F3H.m1 LG1:7929547..7931288
AB201760.1

Sequence(s):
>AY691919.1-F3H2239
atgaacataccctaattacatttcacatgtggtacgatcacgacggtcacatcgtagactttttagagttgaggattatg
gtaaattgatacccccacaacaagatttacactcctcgctacatggtttcaggtaaatccattaatccaatgtccggtcc
ataggatgccaaatattctagaagccaaagataggggggtttggtatagcttgaggccagtctgtgatgactctcaaaga
agaggaggtcactcacgagcccggaggtagttgtagctgccaacatctttttaacgccattcaatcccccaatatatacc
accccttcaccccacaccaaaactcatctttttcttcctctcatttttcacttttttctccacgaaaccccccaaactca
aacattaaaatttctcaggcagatcgctagagagcatatatcagaatggcccctactcctactactctgaccgccatagc
gggggagaagaccctccaacagagcttcgtccgcgacgaagatgagcgccctaaggtggcctacaaccaattcagcaatg
atattccgatcatttccctctccggcatcgaagaggtcgaaggccgccgcgctgagatttgcaagaagattgttgaggcc
tgcgaggactggggcgttttccagattgttgatcacggcatcgaccccaagctcatctcggaaatgactcgtctcgccag
agagttcttcgctttgccgccggaggaaaagctccgtttcgacatgtccggtggcaaaaagggtggcttcatcgtttcca
gccatttacaggtaattaatacaaaacagtttacaaattaactcgactttcatgtcatattataatgtagcgttttgtaa
ctagatgtgaattttattttattaagcggttaaaaaataggtcaacaatgtatgttataacgtgacgcgttttattatgt
gttgctagggagaggcggtgcaggattggcgcgagattgtgacctacttctcatacccggtgcgccaccgtgactactcg
aggtggccggacaagcccgaggggtggagagatgtgacaacgcagtacagtgacgagctgatggggttggcatgcaagct
attggaggttttatcagaggccatgggtttagagaaggaggcattgacaaaggcatgtgtggacatggaccaaaaggttg
tggtgaatttctacccgaaatgcccccagccggacctcactctcggactcaaacgccacacggatcccggtaccattacc
cttttgctgcaggaccaagtcggtggacttcaggccaccagggacggcggaaagacgtggatcaccgttcaacctgtgga
aggagctttcgtggtgaatcttggagaccatggacatgtgagtatacttgtgacaatttcaattattctgattcattatt
cttgattgataattttactattttagtgtcactatcttaatgtgattgtgaaataagcaagataaggacacattaattgt
tatttataccaaactcattatggtcaagatatttttgtaaagaaatcgtgaataatagggtctaggtgcgtggatgttga
agtcatgggtttaatttgatttaattggttaattaatttttatgttacgtatactcaattatatttacccggttagtacg
acccagaaactcatactcaatcatttatggatgtaattcaatggaaaaggagaattatgtttaagtgaagttattttatt
ttcaacatttatatgtaaatatacaaaattgttgattatgagtttcttagtgagttagtgactgagtgaccattaacata
cgcataatatataccaatacgaacgtatagtcttatatgtattgacacattatttgggtgatggaacagtttctgagcaa
tgggaggttcaagaatgctgatcaccaggcggtggtgaactcaaaccacagcaggttgtccatagcgacattccagaacc
cagctcaggaggcgatagtgtacccactgaaggtcagagaaggagagaagccaattctggaggagccgatgacttacact
gagatgtacaagaagaagatgagtaaggaccttgagctagccaggctaaagaagcatgcaaaggagcaactgcaggattc
cgagaaaaccaaacttgaggccaagccagtggacgatatctttgcttaagtgctatgtgtctatcttaattctagagca
back to top
>KC708489.1-F3H.m11542
atgtttctcatagcagcgatcacccttctcgtcgccctggttttgttccggcttcttttctccggcaaatcccaacgtcg
ctcgcttcctctccctcctggccccaaaccatggcccgtggttggaaacctgcctcacttgggcgtttttccgcaccact
ctctcgcggatttggcgcggaaacacggcccgctcatgcacctccgcttcggttacgttgacgtagtcgtggcggcatca
gcatccgtagcgtctcagttcttaaagactcacgacgccaacttctccagccggccacccaactccggcgccaagtacat
ggcttacaactaccaggaccttgtgttcaggccctacggtcctcggtggcgccagttccggaagatcagctccgtccatc
tgttctccggcaaggccttggatgatcttaaacacgtccggcaggaggaggtagctgtgctagcgcatgccttagcaaat
gcagggtcaaaggcagtgaatctggcgcaactgctcaacttgtgcacggtcaacgccctagggcgagtgatggtagggcg
gagggtttttggcgacggcagcggcagcgacgatccaaaggcggacgagttcaaatcgatggtggtggagatgatggtat
tggcaggagtgcccaacataggtgacttcattccctgccttgagtggcttgacttgcaaggcgtggtgtccaagatgaag
aagctccacaagagattcgacgacttcttgacggccattgtcgaggaccacaagaaaagcaccagcacggcggcgcacgt
cgacatgttgaccactctactctccctccaggaagatgccgacggcgaaggtgccaagctcaccgacaccgagatcaagg
ctttgcttttgaacatgttcacagctggcactgatacgtcatcgagcactgtggaatgggcattggctgaacttattaag
caccctcatatgttagcgcgagtccaaaaagagctggacgatgttgttggacatgaccgactcgtgacagaattggatct
acccaacctcacctacctccaagccgtcatcaaggagacgttccggcttcacccgtccactcctctctcattgcctcgta
tggcggccgagagttgtgaaatcaacggctaccacatcccgaagggttccacattgttggtcaatgtatgggccatttcg
cgtgacccggctgaatgggccgaaccattagagttcaggcccgaaaggttcttaccgggcggcgaaaagcctaatgttga
tataagaggaaatgattttgaggtcataccctttggtgctgggagaagaatatgtgctgggatgagcttgggcctccgta
tggtcagtttgatgactgcaacattggtccatgcgtttgattggaccttggcggatgggacacctgagaagttaaacatg
gatgaagcatttgggctcactctacaacgagctgcaccgttaatggtgcacccgcgcacaggccggctagccccacatgc
ttataaaacttcatcatcttaa
back to top
>HM854008.1-F3H.m11533
atgtttctcatagcagcgatcacccttctcgtcgccgtggttctattccggcttcttttctccggcaaatcccaacgtcg
ctcgcttcctctccctcctggccccaaaccatggcctgtcgtcgggaacttgcctcacttgggcccttttccgcaccact
ctctggcggagttggcgcagaaacacgggcccctcatgcacctccgcctcggttatgttgacgtagtggtggcggcatca
gcatccgtagcgtctcagttcttgaagactcacgacgctaacttctccagccggccacccaactccggcgccaagtacat
ggcctacaactaccaggacctcgtgttcaggccctacagtccacggtggcgccagttccggaagatcagctccgtccatc
ttttctccggcaaggccttggatgaccttaaacacgtccggcaggaggaggtagctgtgctagcgcatgccttagcaaat
gcagggtcaaaggtagtgaacctggcgcaactactcaacttgtgcacggtcaacgccctagggcgagtgatggtagggcg
gagggttttcggcgacggcagcggcagcgacgatccgaaggcggacgagttcaagtcaatggtggtggagatgatggtgt
tggcaggagtgcccaacataggtgacttcattccctgccttgagtggcttgacttgcaaggtgtggcgtccaagatgaag
aagctccacaagagattcgacgacttcttgatggccattgtcgaggatcacaagaagagcaccagcacggcggcgcacgt
cgacatgttgaccactctgctctccctccaggaagacgccgacggcgaaggtgccaagctcaccgacaccgagatcaagg
ctttgcttttgaacatgttcacagctggcactgatacgtcatcgagcacggtagaatgggcattggccgaacttattaag
caccctcatatgttagcgcgactccgaaaagagttggatgatgttgttggacatgaccgactcgtgacagaaccggacct
acccaagctcacctacctccaggccgttatcaaggagacgttccggcttcacccgtccactcctctctcattgcctcgta
tggcggccgagagttgtgaaatcaacgggtaccacatcccgaagggttccacattgttagtcaatgtatgggccatatcg
cgtgacccggctgaatgggccgaaccgttggagtttaggcctgaaaggttcttaccgggcggcgaaaagcctaatgttga
tattagaggaaatgattttgaagtcataccctttggtgctgggagaagaatatgtgctgggatgagcttgggcctccgta
tggttagtttgatgactgcaacattggtccatgcgtttgattggaccttggctgatgggacacctgagaagttaaacatg
gatgaagcatttgggctcactctacaacgagctgcaccgttaatgatgcacccgcgcacccggctagccccacatgctta
taaaacttcatca
back to top
>HM854007.1-F3H.m11533
atgtttctcatagcagcgatcacccttctcgtcgccgtggttctattccggcttcttttctccggcaaatcccaacgtcg
ctcgcttcctctccctcctggccccaaaccatggcctgtcgtcgggaacttgcctcacttgggcccttttccgcaccact
ctctggcggagttggcgcagaaacacgggcccctcatgcacctccgcctcggttatgttgacgtagtggtggcggcatca
gcatccgtagcgtctcagttcttgaagactcacgacgctaacttctccagccggccacccaactccggcgccaagtacat
ggcctacaactaccaggacctcgtgttcaggccctacagtccacggtggcgccagttccggaagatcagctccgtccatc
ttttctccggcaaggccttggatgaccttaaacacgtccggcaggaggaggtagctgtgctagcgcatgccttagcaaat
gcagggtcaaaggtagtgaacctggcgcaactactcaacttgtgcacggtcaacgccctagggcgagtgatggtagggca
gagggttttcggcgacggcagcggcagcgacgatccgaaggcggacgagttcaagtcaatggtggtggagatgatggtgt
tggcaggagtgcccaacataggtgacttcattccctgccttgagtggcttgacttgcaaggtgtggcgtccaagatgaag
aagctccacaagagattcgacgacttcttgatggccattgtcgaggatcacaagaagagcaccagcacggcggcgcacgt
cgacatgttgaccactctgctctccctccaggaagacgccgacggcgaaagtgccaagctcaccgacaccgagatcaagg
ctttgcttttgaacatgttcacagctggcactgatacgtcatcgagcacggtagaatgggcattggccgaacttattaaa
caccctcatatgttagcgcgactccgaaaagagttggatgatgttgttggacatgaccgactcgtgacagaaccggacct
acccaagctcacctacctccaggccgttatcaaggagacgttccggcttcacccgtccactcctctctcattgcctcgta
tggcggccgagagttgtgaaatcaacgggtaccacatcccgaagggttccacattgttagtcaatgtatgggccatatcg
cgtgacccggctgaatgggccgaaccgttggagtttaggcctgaaaggttcttaccgggcggcgaaaagcctaatgttga
tattagaggaaatgattttgaagtcataccctttggtgctgggagaagaatatgtgctgggatgagcttgggcctccgta
tggttagtttgatgactgcaacattggtccatgcgtttgattggaccttggctgatgggacacctgagaagttaaacatg
gatgaagcatttgggctcactctacaacgagctgcaccgttaatgatgcacccgcgcacccggctagccccacatgctta
taaaacttcatca
back to top
>AB665441.1-F3H.m11533
atgtttctcatagcagtgattacccttctcgtcgccctggttttgttccggtttcttttctccggcaaatcccaacgtcg
ctcgcttcctctccctcctggccccaaaccatggcccgtggttggaaacctgcctcacttgggcgtttttccgcaccact
ctctcgcggatttggcgcggaaacacggcccgctcatgcacctccgcctcggttacgttgacgtagtcgtggcggcatca
gcatccgtagcgtctcagttcttaaagactcacgacgccaacttctccagccggccacccaactccggcgccaagtacat
ggcttacaactaccaggaccttgtgttcaggccctacggtcctcggtggcgccagttccggaagatcagctccgtccatc
tgttctccggcaaggccttggatgatcttaaacacgtccggcaggaggaggtagctgtgctagcgcatgccttagcaaat
gcagggtcaaaggcagtgaatctggcgcaactgctcaacttgtgcacggtcaacgccctagggcgagtgatggtagggcg
gagggtttttggcgacggcagcggcagcgacgatccaaaggcggacgagttcaaatcgatggtggtggagatgatggtat
tggcaggagtgcccaacataggtgacttcattccctgccttgagtggcttgacttgcaaggcgtggtgtccaagatgaag
aagctccacaagagattcgacgactttttgacggccattgtcgaggaccacaagaaaagcaccggcacggcggcgcacgt
cgacatgttgaccactctgctctccctccaggaagatgccgacggcgaaggtgccaagctcaccgacaccgagatcaagg
ctttgcttttgaacatgttcacagctggcactgatacgtcatcgagcactgtggaatgggcattggctgaacttattaag
caccctcatatgttagcgcgagtccaaaaagagctggacgatgttgttggacatgaccgactcgtgacagaattggatct
acccaacctcacctacctccaagccgttatcaaggagacgttccggcttcacccgtccactcctctctcattgcctcgta
tggcggccgagagttgtgaaatcaacggctaccacatcccgaagggttccacattgttggtcaatgtatgggccatttcg
cgtgacccggctgaatgggccgaaccattagagttcaggcccgaaaggttcttaccgggcggcgaaaagcctaatgttga
tataagaggaaatgattttgaagtcataccctttggtgctgggagaagaatatgtgctgggatgagcttgggcctccgta
tggtcagtttggtgactgcaacattggtccatgcgtttgattggaccttggcggatgggacacctgagaagttaaacatg
gatgaagcatttgggctcactctacaacgagctgcaccgttaatggtgcacccgcgcacccggctagccccacatgctta
taaaacttcataa
back to top
>FJ469980.1-F3H.m1113
tcgcgtgacccggctgaatgggccgaaccattagagttcaggcccgaaaggttcttaccgggcggcgaaaagcctaatgt
tgatataagaggaaatgattttgaagtcatacc
back to top
>AY679608.1-F3H.m1401
cttcagggccccagggacggcggaaagacgtggatcaccgttcaacctgtggaaggagctttcgtggtgaatcttggaga
ccatggacattttctgagcaatgggaggttcaagaatgctgatcaccaggcggtggtgaactcaaaccacagcaggttgt
ccatagcgacattccagaacccagctcaggaggcgatagtgtacccactgaaggtcagagaaggagagaagccaattctg
gaggagccgatgacttacactgagatgtacaagaagaagatgagtaaggaccttgagctagccaggctaaagaagcatgc
aaaggagcactgcaggattcagagaaaaccaaacttgaggccaagccagtggacgatatctttccttctccaggactcat
c
back to top
>AY691919.1-F3H.m11095
atggcccctactcctactactctgaccgccatagcgggggagaagaccctccaacagagcttcgtccgcgacgaagatga
gcgccctaaggtggcctacaaccaattcagcaatgatattccgatcatttccctctccggcatcgaagaggtcgaaggcc
gccgcgctgagatttgcaagaagattgttgaggcctgcgaggactggggcgttttccagattgttgatcacggcatcgac
cccaagctcatctcggaaatgactcgtctcgccagagagttcttcgctttgccgccggaggaaaagctccgtttcgacat
gtccggtggcaaaaagggtggcttcatcgtttccagccatttacagggagaggcggtgcaggattggcgcgagattgtga
cctacttctcatacccggtgcgccaccgtgactactcgaggtggccggacaagcccgaggggtggagagatgtgacaacg
cagtacagtgacgagctgatggggttggcatgcaagctattggaggttttatcagaggccatgggtttagagaaggaggc
attgacaaaggcatgtgtggacatggaccaaaaggttgtggtgaatttctacccgaaatgcccccagccggacctcactc
tcggactcaaacgccacacggatcccggtaccattacccttttgctgcaggaccaagtcggtggacttcaggccaccagg
gacggcggaaagacgtggatcaccgttcaacctgtggaaggagctttcgtggtgaatcttggagaccatggacattttct
gagcaatgggaggttcaagaatgctgatcaccaggcggtggtgaactcaaaccacagcaggttgtccatagcgacattcc
agaacccagctcaggaggcgatagtgtacccactgaaggtcagagaaggagagaagccaattctggaggagccgatgact
tacactgagatgtacaagaagaagatgagtaaggaccttgagctagccaggctaaagaagcatgcaaaggagcaactgca
ggattccgagaaaaccaaacttgaggccaagccagtggacgatatctttgcttaa
back to top
>AY691918.1-F3H.m11095
atggcccctactcctactactctgaccgccatagcgggggagaataccctccaacagagcttcgtccgcgacgaagatga
gcgccctaaggtggcctacaaccaattcagcattgatattccgatcatttccctctccggcatcgaagaggtcgaaggcc
gccgcgctgagatttgcaagaagattgttgaggcctgcgaggactggggcgttttccagattgttgatcacggcatcgac
cccaagctcatctcggaaatgactcgtctcgccagagagttcttcgctttgccgccggaggaaaagctccgtttcgacat
gtccggtggcaaaaagggtggcttcatcgtttccagccatttacagggagaggcggtgcaggattggcgcgagattgtga
cctacttctcatacccggtgcgccaccgtgactactcgaggtggccggacaagcccgaggggtggagagatgtgacaacg
cagtacagtgacgagctgatggggttggcatgcaagctattggaggttttatcagaggccatgggtttagagaaggaggc
attgacaaaggcatgtgtggacatggaccaaaaggttgtggtgaatttctacccgaaatgcccccagccggacctcactc
tcggactcaaacgccacacggatcccggtaccattacccttttgctgcaggaccaagtcggtggacttcaggccaccagg
gacggcggaaagacgtggatcaccgttcaacctgtggaaggagctttcgtggtgaatcttggagaccatggacattttct
gagcaatgggaggttcaagaatgctgatcaccaggcggtggtgaactcaaaccacagcaggttgtccatagcgacattcc
agaacccagctcaggaggcgatagtgtacccactgaaggtcagagaaggagagaagccaattctggaggagccgatgact
tacactgagatgtacaagaagaagatgagtaaggaccttgagctagccaggctaaagaagcatgcaaaggagcaactgca
ggattccgagaaaaccaaacttgaggccaagccagtggacgatatctttgcttaa
back to top
>AB201760.1-F3H.m11095
atggcccctactcctactactctgaccgccatagcgggggagaagaccctccaacagagcttcgtccgcgacgaagatga
gcgccctaaggtggcctacaaccaattcagcaatgatattccgatcatttccctctccggcatcgaagaggtcgaaggcc
gccgcgctgagatttgcaagaagattgttgaggcctgcgaggactggggcgttttccagattgttgatcacggcatcgac
cccaagctcatctcggaaatgactcgtctcgccagagagttcttcgctttgccgccggaggaaaagctccggttcgacat
gtccggtggcaaaaagggtggcttcatcgtttccagccatttacagggagaggcggtgcaggattggcgcgagattgtga
cctacttctcatacccggtgcgccaccgtgactactcgaggtggccggacaagcccgaggggtggagagatgtgacaacg
cagtacagtgacgagctgatggggttggcatgcaagctattggaggttttatcagaggccatgggtttagagaaggaggc
attgacaaaggcatgtgtggacatggaccaaaaggttgtggtgaatttctacccgaaatgcccccagccggacctcactc
tcggactcaaacgccacacggatcccggtaccattacccttttgctgcaggaccaagtcggtggacttcaggccaccagg
gacggcggaaagacgtggatcaccgttcaacctgtggaaggagctttcgtggtgaatcttggagaccatggacattttct
gagcaatgggaggttcaagaatgctgatcaccaggcggtggtgaactcaaaccacagcaggttgtccatagcgacattcc
agaacccagctcaggaggcgatagtgtacccactgaaggtcagagaaggagagaagccaattctggaggagccgatgact
tacactgagatgtacaagaagaagatgagtaaggaccttgagctagccaggctaaagaagcatgcaaaggagcaactgca
ggattcagagaaaaccaaacttgaggccaagccagtggacgatatctttgcttaa
back to top