F3H, F3H (gene) Malus x domestica

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Malus x domestica
Synonym flavonoid 3' hydroxylase IIb
flavonoid 3' hydroxylase IIa
flavonoid 3' hydroxylase
flavanone 3-hydroxylase
flavanon 3 beta-hydroxylase
MdF3H
Description NA
Comment FHT; F3H
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HFJ919633.1-F3H.m1Malus x domesticamRNA
F3HFJ919632.1-F3H.m1Malus x domesticamRNA
F3HFJ919631.1-F3H.m1Malus x domesticamRNA
F3HAF117270.1-F3H.m1Malus x domesticamRNA
F3HAY965340.1-F3H.m1Malus x domesticamRNA
F3HAY965339.1-F3H.m1Malus x domesticamRNA
F3HAB074486.1-F3H.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly FJ919633.1-F3H.m1 Chr06:33501284..33504351
chr6:21701902..21704969
chr6:26649386..26652453
FJ919633.1
predicted genes from whole genome assembly FJ919632.1-F3H.m1 Chr06:33501284..33504351
chr6:21701902..21704969
chr6:26649386..26652453
FJ919632.1
predicted genes from whole genome assembly FJ919631.1-F3H.m1 Chr14:29630944..29634460
chr14:26508325..26511871
chr14:31153914..31157460
FJ919631.1
predicted genes from whole genome assembly AF117270.1-F3H.m1 Chr02:10684927..10686924
chr2:11329043..11331039
chr2:11905961..11907957
AF117270.1
predicted genes from whole genome assembly AY965340.1-F3H.m1 Chr02:10684927..10686924
chr2:11329043..11331039
chr2:11905961..11907957
AY965340.1
predicted genes from whole genome assembly AY965339.1-F3H.m1 Chr02:10684927..10686924
chr2:11329043..11331039
chr2:11905961..11907957
AY965339.1
predicted genes from whole genome assembly AB074486.1-F3H.m1 Chr15:20430086..20432070
chr5:20985661..20987645
chr5:23800734..23802718
AB074486.1

Sequence(s):
>FJ919633.1-F3H.m11536
atgtttgttctcatattcttcaccgttgtcttggccttcttcttataccggctcttcgcccccggcgggagccgccacgc
tctgcctcttccgccagggccgaaaccctggcctgtcgtgggaaacttgccccacttaggccccgttccccatcattctc
tggcggcgttggcccgtcagtatggaccccttatgcacctccgcttggggttcgttgacgtggttgttgcagcctctgct
tcggtggcgtcacagttcttgaagacccacgacgccaatttctccagcagaccacccaactccggcgccaagcatctcgc
ttataactaccaggatttggtgttcgcgccgtacggtccacgatggcggatgttacggaagatcagctccgtccatttgt
tctccggcaaggctctcgatgatcttaaacatgttcgccaggaggaagtaggtgtgctggcacatggattagcaagtgca
gggtcaaagccagtgagcttagggcagctactgaacgtgtgcacagtcaacgccctagggcgggtgatggtagggcggag
gctcttcggagacggcggcgggcgcgaagaccagaaggccgacgagttcaaatccatggtggtggagatgatggtgttgg
ctggcgttttcaacatcggcgacttcatcccggccctcgagtggctggacttgcagggggtggcgggaaagatgaagaag
ctgcacaagaggttcgatgccttcttgaccgccattgttgaagaccacaagaggagcggcgaagggaagcacgtggacat
gctgacgacgttgctgtcgctcacggatgatgctgacggtgagggcgccaagctcacggacactgagattaaagctttgc
ttttgaacatgttcacagctggcactgacacgtcatcaagcacggtggaatgggccatagcagaactccttcgccacccc
aagattctagcccaactccaacaagagctggaccaagtagtgggccgggaccggctcgtaaccgagtcggacctgcccaa
cttgacctacctccaagcagtaatcaaggaaacctttcggctacacccgtcaaccccgctctccctgcctcgaatggcgt
ccgagagttgcgaaatcaacgggttccacatccccaagggtgccactcttctggtcaacgtatgggccatatctcgcgac
ccggcccaatggtccgaaccgcttgagtttagacccgagcggttcttgccgggtggagagaagcccaatgtggacgtcaa
gggtaatgatttcgaggttataccgtttggggccgggcggagaatatgcgccgggatgacccttgggctgcgtatggtgt
ctctaatgatcgcgaccctggtccatggttttgattggaccttggctgatgggctcacacctgagaaattgaacatggac
gaggcttatgggctcacactacaaagagccgcaccattaatggtgcacccacgtaacaggctagcccctcatgcatataa
tgcgtcatcaccttga
back to top
>FJ919632.1-F3H.m11536
atgtttgttctcatattcttcaccgttgtcttggccttcttcttatacaggctcttcgcccccggcgggagccgccacgc
tcagccccttccaccagggccgaaaccctggcctgtcgtgggaaacttgccccacttaggccccgttccccatcactctc
tggcggcgttggcccgtcagtatggaccccttatgcacctccgcttggggttcgttgacgtggttgttgcagcctctgct
tcggtggcgtcacagttcttgaagacccacgacgccaatttctctagcagaccacccaactccggcgccaagcatctcgc
ttataactaccaggatttggtgttcgcgccgtacggtccacgatggcggatgttacggaagatcagctccgtccatttgt
tctccggcaaggctctcgatgatcttaaacatgttcgccaggaggaagtaggtgtgctggcacatggattagcaagtgca
gggtcaaagccagtgaacttagggcagctactgaacgtgtgcacagtcaacgccctagggcgggtgatggtagggcggag
gctcttcggagacggcggcgggcgcgaagaccagaaggccgacgagttcaaatccatggtggtggagatgatggtgttgg
ctggcgttttcaacatcggcgacttcatcccggccctcgagtggctggacttgcagggggtggcgggaaagatgaagaag
ctgcacaagaggttcgatgccttcttgaccgccattgttgaagaccacaagaggagcggcgaagggaagcacgtggacat
gctgacgacgttgctgtcgctcacggatgatgctgacggtgagggcgccaagctcacggacactgagattaaagctttgc
ttttgaacatgttcacagctggcactgacacgtcatcaagcacggtggaatgggccatagcagaactccttcgccacccc
aagattctagcccaactccaacaagagctggaccaagtagcggggcgggatcggctcataaccgagtcggacctgcctaa
cttgacctacctccaagcagtaatcaaggaaacctttcggctacacccgtcaaccccgctctccctgcctcgaatggcgt
ccgagagttgcgaaatcaacgggttccacatccccaagggtgccactcttctggtcaacgtatgggccatatctcgcgac
ccggcccaatggtccgaaccgcttgagtttagacccgagcggttcttgccgggtggagagaagcccaatgtggacgtcaa
gggtaatgatttcgaggttataccgtttggggccgggcggagaatatgcgccgggatgacccttgggctgcgtatggtgt
ctctaatgaccgcgaccctggtccatggttttgattggaccttggctgatgggctcacacctgagaaattgaacatggac
gaggcttatgggctcacactacaaagagccgcaccattaatggtgcacccacgtaacaggctagcccctcatgcatataa
tgcgtcatcaccttga
back to top
>FJ919631.1-F3H.m11536
atgtttgttctcatagtcttcaccgtcgtctttgccttcttcttataccggatatttgcccctggcgggagccgtcactc
tctgcctcttccgccggggccgaaaccttggcctgtagtagggaacctgccccacttaggccccgttccccaccactctc
tggcggctttggcccgtcagtatggacccctcatgcacctccgcttggggtttgttgacgtggttgttgccgcctccgcc
tccgtggcgtcacagtttctgaagacccatgacgctaatttctcgagccggccacccaactccggcgccaagcatctcgc
ttacaactaccaagacttggtgttcgcgccgtacggtccacggtggcgattgttgcggaagatcagctccgtccatttgt
tctccggcaaggctctggatgatcttaaacacgttcgccaggaggaggtaggtgtgcttgcacatggattagcaagtgca
gggtcaaagccagtgaacttggcgcaactactgaacgtgtgcacggtgaacgccctagggcgggtgatggtaggacggag
gctcttcggcaacggcatgggcggcgaagacccaaaggcggatgagttcaagtccatggtggtggagatgatggtgttgg
ccggagtattcaacatcggcgacttcatcccctccctagagtggctggacttgcagggggtggcgggaaagatgaagaag
ctacacaagaggttcgatgccttcttgaccgccattgttgaagagcacaagaggagccgcggagggaagcacgtcgacat
gctgacgacgttgctgtcgctcaaggaggatgccgacggtgagggcgccaagctcacagacactgagattaaagctttgc
ttttgaacatgtttacagctggcactgacacgtcatcaagcacagtggaatgggccatagccgaactccttcgccacccc
aaaattctagcccaactccaacaagagctggatcaagtcgtgggtcgggaccggctcgtaaccgaatcggacctgcccaa
cctgacctacctccaagccgtgatcaaggaaaccttccggctccacccatccaccccgctctctcttccccgaatggcga
ccgagagttgcgaaatcaacggatttcacattcctaagggtgccactctcttggtcaacgtatgggccgtatctcgcgat
ccggatcaatggtccgaaccgctcgagtttaggcccgagcggttcatgtcgggaggtgagaagcccaatgtcgacattag
ggggaatgacttcgaggtcataccgttcggggccgggcgtagaatatgtgccgggatgagccttgggttgcggatggtgt
ctctgatgactgcaaccctggtccatggttttgattggaccttggccgatgggctgacccctgagaagttgaacatggac
gaggcctatgggctcaccctacaaagagccgcaccgttaatggtgcacccgcgtaacaggctagcccctcatgcatacaa
tgcatcatcatcttga
back to top
>AF117270.1-F3H.m11095
atggctcctgctactacgctcacatccatagcgcatgagaaaaccctgcaacaaaaatttgtccgagacgaagacgagcg
tccaaaggttgcctacaacgacttcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggtggaaggccgcc
ggggcgagatttgcaagaagattgtagcggcttgtgaagactggggtattttccagattgttgaccatggggttgatgct
gagctcatatcggaaatgaccggtctcgctagagagttctttgctttgccatcggaggagaagctccgcttcgacatgtc
cggtggcaaaaagggtggcttcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtgacct
acttttcatatccgattcgtcaccgggactattcgaggtggccagacaagcctgaggcctggagggaggtgacaaagaag
tacagtgacgagttgatggggctggcatgcaagctcttgggcgttttatcagaagccatggggttggatacagaggcatt
gacaaaggcatgtgtggacatggaccaaaaagtcgtcgtgaatttctacccaaaatgccctcagcccgacctaacccttg
gcctcaagcgccataccgacccgggcacaattacccttctgcttcaagaccaagttgggggcctccaggctactcgggat
gatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatcatggtcatcttctgag
caatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagcagcaggctgtccatagccacattccaga
acccagcgcaagaagcaatagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccaatcacctac
accgagatgtacaagaagaagatgagcaaggatcttgagctcgccaggctgaaaaaactggccaaggaacagcaatcgca
ggacttggagaaagccaaagtggatacaaagccagtggacgacatttttgcttag
back to top
>AY965340.1-F3H.m11098
atggctcctgctactactacgctcacatccatagcgcatgagaaaaccctacaacaaaaatttgtccgagacgaagacga
gcgtccaaaggttgcctacaacgacttcagcaacgaaattccgatcatctcgcttgccgggcttgatgaggtggaaggac
gccggggcgagatttgcaagaagattgtagcggcttgtgaggactggggtattttccagattgttgaccatggggttgat
gctgagctcatatcggaaatgaccggtctcgctagagagttctttgctttgccatctgaggagaagctccgcttcgacat
gtccggtggcaaaaagggtggcttcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtga
cctacttttcatatccgattcgtcaccgggactattcgaggtggccagacaagcctgaggcctggagggaggtgacaaag
aagtacagtgacgagttgatggggctggcatgcaagctcttgggggttttatcagaagccatggggttggatacagaggc
attgacaaaggcatgtgtggacatggaccaaaaagtcgtcgtaaatttctacccaaaatgccctcagcccgacctgaccc
ttggcctcaagcgccacaccgacccgggcacaattacccttctgcttcaagaccaagttgggggcctccaggctacacgg
gatgatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatcatggtcatcttct
gagcaatgggagggtcaagaatgctgatcaccaagcagtggtgaactcaaacagcagcaggctgtccatagccacattcc
agaacccagcgcaagaagcaatagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccaatcacc
tacaccgagatgtacaagaagaagatgagcaaggatcttgagcttgccaggctgaaaaaactgtccaaggaacagcaact
gcaggacttggagaaagccaaagtggatacaaagccagtggacgacatttttgcttag
back to top
>AY965339.1-F3H.m11098
atggctcctgctactactacgctcacatccatagcgcatgagaaaaccctacaacaaaaatttgtccgagacgaagacga
gcgtccaaaggttgcctacaacgacttcagcaacgaaattccgatcatctcgcttgccgggattgatgaggtggaaggac
gccggggcgagatttgcaagaagattgtagcggcttgtgaggactggggtattttccagattgttgaccatggggttgat
gctgagctcatatcggaaatgaccggtctcgctagagagttctttgctttgccatcggaggagaagctccgcttcgacat
gtccggtggcaaaaagggtggcttcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtga
cctacttttcatatccgattcgtcaccgggactattcgaggtggccagacaagcctgaggcctggagggaggtgacaaag
aagtacagtgacgagttgatggggctggcatgcaagctcttgggggttttatcagaagccatggggttggatacagaggc
attgacaaaggcatgtgtggacatggaccaaaaagtcgtcgtgaatttctacccaaaatgccctcagcccgacctaaccc
ttggcctcaagcgccacaccgacccgggcacaattacccttctgcttcaagaccaagttgggggcctccaggctacacgg
gatgatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatcatggtcatcttct
gagcaatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagcaataggctgtccatagccacattcc
agaacccagcgcaagaagcaatagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccaatcacc
tacaccgagatgtacaagaagaagatgagcaaggatcttgagcttgccaggctgaaaaaactgtccaaggaacagcaact
gcaggacttggagaaagccaaagtggatacaaagccagtggacgacatttttgcttag
back to top
>AB074486.1-F3H.m11098
atggctcctcctgctactacgctgacatccattgcgcatgagaaaaccctacaacaaaaattcgtccgagacgaagacga
gcgtccaaaggttgcctacaacgaattcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggttgaaggcc
gccgggccgagatttgcaagaagattgtggaagcttgtgaggactggggtattttccagattgttgatcatggagttgat
gccgagctcatatcggaaatgaccggtctcgccaaagagttctttgatttgccatcggaggagaagctccgcttcgacat
gtccggtggcaaaaagggtggattcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtga
cctactttttatacccgattcgccaccgggactactcgaggtggccggacaagccagaggcatggagggaggtgacgaag
aagtacagcgacgagctgatggggctggcatgcaagctcttgggggttttatcagaagccatggggttggatacagaggc
attgacaaaggcatgtgtggacatggaccaaaaagtggtggtgaatttctatccgaagtgccctcagcccgacctaactc
ttggcctcaagcgccacacggacccgggcacaattacccttttgcttcaggaccaagttggtggccttcaggctactagg
gatgatgggaagacatggatcaccgttcaaccagtggaaggagcttttgtggtcaatctcggagatcatggtcattttct
gagcaatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagcagcaggctgtccatagccacattcc
agaacccagctcaagatgcaatagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccgatcacc
tacaccgagatgtacaagaagaagatgagcaaagatcttgagcttgccaggctgaaaaagctggccaaggaacagcaact
gcaggacttggagaaagccaaagtggagacaaagccagcggacgacatatttgcttag
back to top