F3H, F3H (gene) Malus hybrid cultivar

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Malus hybrid cultivar
Synonym flavonoid 3' hydroxylase
flavanone 3-hydroxylase protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HKF481684.1-F3H.m1Malus hybrid cultivarmRNA
F3HFJ817486.1-F3H.m1Malus hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HMalus hybrid cultivargene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly KF481684.1-F3H.m1 Chr06:33501284..33504351
chr6:21701902..21704969
chr6:26649386..26652453
KF481684.1
predicted genes from whole genome assembly FJ817486.1-F3H.m1 Chr02:10684927..10686924
chr2:11329043..11331039
chr2:11905961..11907957
FJ817486.1

Sequence(s):
>KF481684.1-F3H.m11536
atgtttgttctcatattcttcaccgttgtcttggccttcttcttatacaggctcttcgcccccggcgggagccgccacgc
tcagccccttccaccagggccgaaaccctggcctgtcgtgggaaacttgccccacttaggccccgttccccatcactctc
tggcggcgttggcccgtcagtatggaccccttatgcacctccgcttggggttcgttgacgtggttgttgcagcctctgct
tcggtggcgtcacagttcttgaagacccacgacgccaatttctcyagcagaccacccaactccggcgccaagcatctcgc
ttataactaccaggatttggtgttcgcgccgtacggtccacgatggcggatgttacggaagatcagctccgtccatttgt
tctccggcaaggctctcgatgatcttaaacatgttcgccaggaggaagtaggtgtgctggcacatggattagcaagtgca
gggtcaaagccagtgaacttagggcagctactgaacgtgtgcacagtcaacgccctagggcgggtgatggtagggcggag
gctcttcggagacggcggcgggcgcgaagaccagaaggccgacgagttcaaatccatggtggtggagatgatggtgttgg
ctggcgttttcaacatcggcgacttcatcccggccctcgagtggctggacttgcagggggtggcgggaaagatgaagaag
ctgcacaagaggttcgatgccttcttgaccgccattgttgaagaccacaagaggagcggcgaagggaatcacgtggacat
gctgacgacgttgctgtcgctcacggatgatgctgacggtgagggcgccaagctcacggacactgagattaaagctttgc
ttttgaacatgttcacagctggcactgacacgtcatcaagcacggtggaatgggccatagcagaactccttcgccacccc
aagattctagcccaactccaacaagagctggaccaagtagcgggccgggatcggctcgtaaccgagtcggacctgcctaa
cttgacctacctccaagcagtaatcaaggaaacctttcggctacacccgtcaaccccgctctccctgcctcgaatggcgt
ccgagagttgcgaaatcaacgggttccacatccccaagggtgccactcttctggtcaacgtatgggccatatctcgcgac
ccggcccaatggtccgaaccgcttgagtttagacccgagcggttcttgccgggtggagagaagcccaatgtggacgtcaa
gggtaatgatttcgaggttataccgtttggggccgggcggagaatatgcgccgggatgacccttgggctgcgtatggtgt
ctctaatgactgcgaccctggtccatggttttgattggaccttggctgatgggcttacacctgagaaattgaacatggac
gaggcttatgggctcacactacaaagagccgcaccattaatggtgcacccacgtaacaggctagcccctcatgcatataa
tgcgtcatcaccttga
back to top
>FJ817486.1-F3H.m11095
atggctcctgctactacgctcacatccatagcgcatgagaaaaccctgcaacaaaaatttgtccgagacgaagacgagcg
tccaaaggttgcctacaacgacttcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggtggaaggccgcc
ggggcgagatttgcaagaagattgtagcggcttgtgaagactggggtattttccagattgttgaccatggggttgatgct
gagctcatatcggaaatgaccggtctcgctagagagttctttgctttgccatcggaggagaagctccgcttcgacatgtc
cggtggcaaaaagggtggcttcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtgacct
acttttcatatccgattcgtcaccgggactattcgaggtggccagacaagcctgaggcctggagggaggtgacaaagaag
tacagtgacgagttgatggggctggcatgcaagctcttgggcgttttatcagaagccatggggttggatacagaggcatt
gacaaaggcatgtgtggacatggaccaaaaagtcgtcgtgaatttctacccaaaatgccctcagcccgacctaacccttg
gcctcaagcgccataccgacccgggcacaattacccttctgcttcaagaccaagttgggggcctccaggctactcgggat
gatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatcatggtcatcttctgag
caatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagcagcaggctgtccatagccacattccaga
acccagcgcaagaagcaatagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccaatcacctac
accgagatgtacaagaagaagatgagcaaggatcttgagctcgccaggctgaaaaaactggccaaggaacagcaatcgca
ggacttggagaaagccaaagtggatacaaagccagtggacgacatttttgcttag
back to top