F3H, F3H (gene) Prunus avium

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Prunus avium
Synonym flavanone 3-hydroxylase
flavanone-3-hydroxylase
Description NA
Comment flavonoid pathway enzyme
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HJF740092.1-F3H.m1Prunus aviummRNA
F3HKP347503.1-F3H.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JF740092.1-F3H.m1 N/A JF740092.1
mRNA parsed from NCBI nr database KP347503.1-F3H.m1 N/A KP347503.1

Sequence(s):
>JF740092.1-F3H.m11083
atggctcctgctactactctcacctccattgcaggggagaaaaccctgcaacaaaaatttgtccgggacgaagatgagcg
ccccaaggttgcctacaacaacttcagcaatgaaatcccgatcatttcgcttgccgggatcgacgaggaaggccgccggg
ccgagatttgcaagaagattgtggaggcttgtgaggattggggtatttaccagattgttgatcatggagttgatgccaag
ctcatctctgaaatgaccggtctcgccagagagttcttcgctttgccgtccgaggagaagcttcgctttgacatgtccgg
cggcaaaaagggtggtttcatcgtctccagccatttacagggagaagccgtgcaagattggcgcgaaattgtgacatact
tctcatacccaatccggcaccgggactattcgaggtggccggacaagccagagggatggagagaggtgacacagaagtac
agcgacgagctgatggggctggcatgcaagcttttgggggtgttatcagaagccatgggattggatacagaggcattgac
aaaggcgtgtgtagacatggaccaaaaagttgtggtcaatttctacccaaaatgcccccaacccgacctcacccttggcc
tgaagcgccacactgacccaggcacaattacccttttgctccaagaccaggttggtggcctccaggctacaagggatggt
gggaagacgtggatcaccgttcaaccagtggaaggagccttcgtggtcgatcttggagaccatggtcatcttctgagcaa
tgggaggttcaagaatgctgatcaccaagcagttgtgaactcaaacagcagcaggctgtccatagccacattccagaacc
cagcccaagaagctatagtctacccactgagcatcagagagggagagaagcccattctagaggggccaatcacctacaca
gagatgtacaagaagaagatgggcagggaccttgagcttgccaggctaaaaaagctggccaaggagcaacaatcgcagga
cttgaagaaggagaccaagtcagccgatgatatttttgcttag
back to top
>KP347503.1-F3H.m11083
atggctcctgctactactctcacctccattgcaggggagaaaaccctgcaacaaaaatttgtccgggacgaagatgagcg
ccccaaggttgcctacaacaacttcagcaatgaaatcccgatcatttcgcttgccgggatcgacgaggaaggccgccggg
ccgagatttgcaagaagattgtggaggcttgtgaggattggggtatttaccagattgttgatcatggagttgatgccaag
ctcatctctgaaatgaccggtctcgccagagagttcttcgctttgccgtccgaggagaagcttcgctttgacatgtccgg
cggcaaaaagggtggtttcatcgtctccagccatttacagggagaagctgtgcaagattggcgcgaaattgtgacatact
tctcatacccaatccggcaccgggactattcgaggtggccggacaagccagagggatggagagaggtgacacagaagtac
agcgacgagctgatggggctggcatgcaagcttttgggggtgttatcagaagccatgggattggatacagaggcattgac
aaaggcgtgtgtagacatggaccaaaaagttgtggtcaatttctacccaaaatgcccccaacccgacctcacccttggcc
tgaagcgccacactgacccaggcacaattacccttttgctccaagaccaggttggtggcctccaggctacaagggatggt
gggaagacgtggatcaccgttcaaccagtggaaggagccttcgtggtcaatcttggagaccatggtcatcttctgagcaa
tgggaggttcaagaatgctgatcaccaagcagttgtgaactcaaacagcagcaggctgtccatagccacattccagaacc
cagcccaagaagctatagtctacccactgagcatcagagagggagagaagcccattctagaggggccaatcacctacaca
gagatgtacaagaagaagatgggcagggaccttgagcttgccaggctaaaaaagctggccaaggagcaacaatcgcagga
cttgaagaaggagaccaagtcagccgatgatatttttgcttag
back to top