F3H, F3H (gene) Prunus persica

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Prunus persica
Synonym flavanone 3-hydroxylase
flavonoid 3' hydroxylase
pPpF3H
Description NA
Comment PpF3'H
key enzyme of phenylalanine metabolic pathway; synthesis of flavonoid substances; role in regulating pigment synthesis
flavonoid pathway enzyme; alternatively spliced
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HJQ717267.1-F3H.m1Prunus persicamRNA
F3HJQ697494.1-F3H.m1Prunus persicamRNA
F3HHM543570.1-F3H.m1Prunus persicamRNA
F3HAB097151.1-F3H.m1Prunus persicamRNA
F3HKJ524274.1-F3H.m1Prunus persicamRNA
F3HKJ484546.1-F3H.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JQ717267.1-F3H.m1 scaffold_7:17534747..17534877
JQ717267.1
mRNA parsed from NCBI nr database JQ697494.1-F3H.m1 scaffold_5:16354314..16356884
JQ697494.1
mRNA parsed from NCBI nr database HM543570.1-F3H.m1 scaffold_7:17533084..17534913
HM543570.1
mRNA parsed from NCBI nr database AB097151.1-F3H.m1 scaffold_7:17533180..17534711
AB097151.1
mRNA parsed from NCBI nr database KJ524274.1-F3H.m1 N/A KJ524274.1
mRNA parsed from NCBI nr database KJ484546.1-F3H.m1 N/A KJ484546.1

Sequence(s):
>JQ717267.1-F3H.m1130
agagggagagaagcccattctagaggggccaatcacctacacagagatgtacaagaagaagatgaccaaggaccttgagc
ttgccaggctcaaaaagctggccaaggagcaacaattgcaggactcggag
back to top
>JQ697494.1-F3H.m11533
atgtttattctcatattcatcaccgtcgtcttcgccgccctcttgtaccgtcttctgttctccggcaaccgccactccct
ccctctcccccccggcccaaagccgtggcctattgttgggaatttgcctcatttgggccccgtcccccaccactccctcg
ccgccttggcccgccagtatgggcctctcatgcacctccgcctcggcttcgttgacgttgtcgtcgccgcctccgcctca
gtggcgtcccagttcctgaagacccacgacaccaacttctcaagccggccgcccaactctggcgccaagcatctcgctta
taactaccacgatttggtgtttgcaccgtacggtccgcgctggcggatgttgcggaagatcagctcagtccatttgttct
ccggcaaggctttggatgatcttcgacatgttcgccaggaggaggtagctgtgctggctcatggcttagcaggtgccggg
tcaaagccagtgaacttggctcagcttctaaatgtatgcacggtcaacgccctagggcgggtgatggtggggaagaggtt
gtttggtgacggcagcggcagcggcgacgagaaggcggacgagttcaaggagatggttgtggagatgatggtgttggcag
gagtgttcaacataggtgactttatccccgccctcgagtggctggacttgcagggcgtggcggcgaagatgaagaagctg
cacaagaggtttgatgccttcttgaccgccattgttgaagaacacaagaagagcagcggcggaaagcatggggacatgtt
gactactttactctcgctcaaagaggatgctgacggtgagggggccaagctgacagacaccgagattaaagctttgcttt
tgaatatgttcacagcaggtactgacacgtcatcaagcacagtggaatgggctatagcagaactccttcgccaccccaag
attctggcccaagtccaacaagaacttgaccaagttgtgggccgagaccagcttgtaactgaactggacctacccaactt
gacctacctccaggccgtgatcaaggaaaccttccggctccacccgtccacccctctctcgttgcctcgcatggcatctg
aaagttgcgaaattaacagcttccacatcccaaagggcgccactctcttagtcaatgtatgggccatatcacgtgaccca
gagcaatggaaggagccacttgagttccgacccgaaaggttcctaccgggcggggagaagcctcatgtggatgttagagg
gaatgattttgaagtgatcccatttggtgctgggcgcagaatatgtgcggggatgagcctgggcttgcgtatggtccatc
taatggctgcaaccctggtccatgcatttgactggaccttggctgatgggctaaccccagagaaattgaacatggacgaa
gcatatgggctcactttacaacgagcggcacctctaatggtgcacccgcgcacaaggctagcccctcatgcatacgaagc
atcatcatcttga
back to top
>HM543570.1-F3H.m11086
atggctcctgctactactctcacctccatagcaggggagaaaaccctgcaacaaaaatttgtccgggacgaagatgagcg
ccccaaggttgcctacaacaacttcagcaatgaaatcccgatcatttcgcttgccgggatcgacgaggtggaaggccgcc
gggctgatatttgcaagaagattgtggaggcttgtgaggattggggtattttccagattgttgatcatggagttgatacc
aagctcatctcggaaatgaccggtctcgccagagagttcttcgctctgccctcggaggagaagcttcgttttgacatgtc
cggcggcaaaaagggtggtttcatcgtctccagccatttacagggagaagctgtgcaagattggcgcgaaattgtgacat
acttctcatacccaatccggcaccgggactattcgaggtggccggacaagccggaaggatggagagaggtgacacagaag
tacagcgacgagctgatggggctggcatgcaagcttttgggggtgttatcagaagccatgggactggacacagaggcatt
gacaaaggcgtgtgtagacatggaccaaaaagttgtggtcaatttctacccaaaatgcccccaacccgacctcacccttg
gcctgaagcgccacactgacccaggcacaattacccttttgctccaagaccaggttggtggcctccaggctaccagggat
gatgggaagacgtggatcaccgttcaaccagtggaaggagccttcgtggtcaatcttggggaccatggtcattttctgag
caatgggaggttcaagaatgctgatcaccaagcagttgtgaactcaaacagcagcaggctgtccatagccacattccaaa
acccagctcaagaagctacagtctacccactgagcatcagagagggagagaagcccattctagaggggccaatcacctac
acagagatgtacaagaagaagatgaccaaggaccttgagcttgccaggctcaaaaagctggccaaggagcaacaattgca
ggactcggagaaggagggcaagccaaaggatgatatttttgcttag
back to top
>AB097151.1-F3H.m1809
gagcgtcccaaagtcgcttataacaacttcagcaatgaaatcccgatcatttcgcttgccgggatcgacgaggtggaagg
ccgccgggctgatatttgcaagaagattgtggaggcttgtgaggattggggtattttccagattgttgatcatggagttg
ataccaagctcatctcggaaatgaccggtctcgccagagagttcttcgctctgccctcggaggagaagcttcgttttgac
atgtccggcggcaaaaagggtggtttcatcgtctccagccatttacagggagaagctgtgcaagattggcgcgaaattgt
gacatacttctcatacccaatccggcaccgggactattcgaggtggccggacaagccggaaggatggagagaggtgacac
agaagtacagcgacgagctgatggggctggcatgcaagcttttgggggtgttatcagaagccatgggactggacacagag
gcattgacaaaggcgtgtgtagacatggaccaaaaagttgtggtcaatttctacccaaaatgcccccaacccgacctcac
ccttggcctgaagcgccacactgacccaggcacaattacccttttgctccaagaccaggttggtggcctccaggctacca
gggatgatgggaagacgtggatcaccgttcaaccagtggaaggagccttcgtggtcaatcttggggaccatggtcatttt
ctgagcaatgggaggttcaagaatgctgatcaccaagcagttgtgaactctaacagcagcaggctgtccatagccacctt
ccagaaccc
back to top
>KJ524274.1-F3H.m11530
atgggggaacataaaatgtttattctcatattcatcaccgtcgtcttcgccgccctcttgtaccgtcttctgttctccgg
caaccgccactccctccctctcccccccggcccaaagccgtggcctattgttgggaatttgcctcatttgggccccgtcc
cccaccactccctcgccgccttggcccgccagtatgggcctctcatgcacctccgcctcggcttcgttgacgttgtcgtc
gccgcctccgcctcagtggcgtcccagttcctgaagacccacgacaccaacttctcaagccggccgcccaactctggcgc
caagcatctcgcttataactaccacgatttggtgtttgcaccgtacggtccgcgctggcggatgttgcggaagatcagct
cagtccatttgttctccggcaaggctttggatgatcttcgacatgttcgccaggaggaggtagctgtgctggctcatggc
ttagcaggtgccgggtcaaagccagtgaacttggctcagcttctaaatgtatgcacggtcaacgccctagggcgggtgat
ggtggggaagaggttgtttggtgacggcagcggcagcggcgacgagaaggcggacgagttcaaggagatggttgtggaga
tgatggtgttggcaggagtgttcaacataggtgactttatccccgccctcgagtggctggacttgcagggcgtggcggcg
aagatgaagaagctgcacaagaggtttgatgccttcttgaccgccattgttgaagaacacaagaagagcagcggcggaaa
gcatggggacatgttgactactttactctcgctcaaagaggatgctgacggtgagggggccaagctgacagacaccgaga
ttaaagctttgcttttgaatatgttcacagcaggtactgacacgtcatcaagcacagtggaatgggctatagcagaactc
cttcgccaccccaagattctggcccaagtccaacaagaacttgaccaagttgtgggccgagaccagcttgtaactgaact
ggacctacccaacttgacctacctccaggccgtgatcaaggaaaccttccggctccacccgtccacccctctctcgttgc
ctcgcatggcatctgaaagttgcgaaattaacagcttccacatcccaaagggcgccactctcttagtcaatgtatgggcc
atatcacgtgacccagagcaatggaaggagccacttgagttccgacccgaaaggttcctaccgggcggggagaagcctca
tgtggatgttagagggaatgattttgaagtgatcccatttggtgctgggcgcagaatgtgtgcggggatgagcctgggct
tgcgtatggtccatctaatggctgcaaccctggtccatgcatttgactggaccttggctgatgggctaaccccagagaaa
ttgaacatggacgaagcatatgggctcactttacaacgagcggcacctctaatggtgcacccgcgcacaaggctagcccc
tcatgcatga
back to top
>KJ484546.1-F3H.m11530
atgggggaacataaaatgtttattctcatattcatcaccgtcgtcttcgccgccctcttgtaccgtcttctgttctccgg
caaccgccactccctccctctcccccccggcccaaagccgtggcctattgttgggaatttgcctcatttgggccccgtcc
cccaccactccctcgccgccttggcccgccagtatgggcctctcatgcacctccgcctcggcttcgttgacgttgtcgtc
gccgcctccgcctcagtggcgtcccagttcctgaagacccacgacaccaacttctcaagccggccgcccaactctggcgc
caagcatctcgcttataactaccacgatttggtgtttgcaccgtacggtccgcgctggcggatgttgcggaagatcagct
cagtccatttgttctccggcaaggctttggatgatcttcgacatgttcgccaggaggaggtagctgtgctggctcatggc
ttagcaggtgccgggtcaaagccagtgaacttggctcagcttctaaatgtatgcacggtcaacgccctagggcgggtgat
ggtggggaagaggttgtttggtgacggcagcggcagcggcgacgagaaggcggacgagttcaaggagatggttgtggaga
tgatggtgttggcaggagtgttcaacataggtgactttatccccgccctcgagtggctggacttgcagggcgtggcggcg
aagatgaagaagctgcacaagaggtttgatgccttcttgaccgccattgttgaagaacacaagaagagcagcggcggaaa
gcatggggacatgttgactactttactctcgctcaaagaggatgctgacggtgagggggccaagctgacagacaccgaga
ttaaagctttgcttttgaatatgttcacagcaggtactgacacgtcatcaagcacagtggaatgggctatagcagaactc
cttcgccaccccaagattctggcccaagtccaacaagaacttgaccaagttgtgggccgagaccagcttgtaactgaact
ggacctacccaacttgacctacctccaggccgtgatcaaggaaaccttccggctccacccgtccacccctctctcgttgc
ctcgcatggcatctgaaagttgcgaaattaacagcttccacatcccaaagggcgccactctcttagtcaatgtatgggcc
atatcacgtgacccagagcaatggaaggagccacttgagttccgacccgaaaggttcctaccgggcggggagaagcctca
tgtggatgttagagggaatgattttgaagtgatcccatttggtgctgggcgcagaatgtgtgcggggatgagcctgggct
tgcgtatggtccatctaatggctgcaaccctggtccatgcatttgactggaccttggctgatgggctaaccccagagaaa
ttgaacatggacgaagcatatgggctcactttacaacgagcggcacctctaatggtgcacccgcgcacaaggctagcccc
tcatgcatga
back to top