F3H, F3H (gene) Pyrus communis

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Pyrus communis
Synonym flavanone 3' hydroxylase
flavanone 3-hydroxylase
flavanon 3 beta-hydroxylase
Description NA
Comment F3H
FHT; F3H
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HJX403951.1-F3H.m1Pyrus communismRNA
F3HJX403950.1-F3H.m1Pyrus communismRNA
F3HKC460396.1-F3H.m1Pyrus communismRNA
F3HHM775218.1-F3H.m1Pyrus communismRNA
F3HAF497633.1-F3H.m1Pyrus communismRNA
F3HAY965342.1-F3H.m1Pyrus communismRNA
F3HAY965341.1-F3H.m1Pyrus communismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HPyrus communisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JX403951.1-F3H.m1 N/A JX403951.1
mRNA parsed from NCBI nr database JX403950.1-F3H.m1 scaffold00729:88641..90783
JX403950.1
mRNA parsed from NCBI nr database KC460396.1-F3H.m1 N/A KC460396.1
mRNA parsed from NCBI nr database HM775218.1-F3H.m1 scaffold00729:88697..89983
HM775218.1
mRNA parsed from NCBI nr database AF497633.1-F3H.m1 scaffold00729:88641..90783
AF497633.1
mRNA parsed from NCBI nr database AY965342.1-F3H.m1 scaffold00729:88641..90783
AY965342.1
mRNA parsed from NCBI nr database AY965341.1-F3H.m1 scaffold00729:88641..90783
AY965341.1

Sequence(s):
>JX403951.1-F3H.m11536
atgtttgttctcatagtcttcaccgttgtctttgccttcttcttataccggatctttgcccccggntggagccgtcactc
tctgcctcttccgccggggccgaaaccttggcctatagnagggaacttgccccacttaggccccgttccccaccactctc
tggcggctttggcccgtcagtatggacccctcatgcacctccgcttggggtttgttgacgtggttgttgccncctccgcc
tccgtggcgtcacagtttntgaaaacccntgacgntaatttctcgagccggccacccaactccggcgccaagcatctngc
ttacaactaccagganttggtgttcgcgccgtacggtccacgntggcggatgttncggaagatcagctccgtccatttgt
tctcnggcaaggctctngatgatcttaaacatgttcgccaggaggaggtgggtgtgcttgcacatggattagcaagtgca
ggatcaaggccagtgaacttggcgcagctactgaacgtgtgcacggtgaacgccctagggcgggtgatggtaggacggag
gctcttcggcaacggcaagggcggcgaagacccaaaggcggatgagttcaagtccatggtggtggagatgatggtgttgg
ctggcgttttcaacattggcgacttcattccggccctcgagtggctggacttgcagggggtggcgggaaagatgaagaag
ctgcacaagaggttcgatgccttcttgaccgccattgttgaagaccacaagaggagcggcgaagggaagcacgtggacat
gctgacgacgttgctgtctctcaaggatgatgctgacgatgagggcgccaagctcacggacactgagattaaagctttgc
ttttgaacatgttcacagctggcactgacacgtcatcaagcacggtggaatgggccatagcnnnnnncnntnnncacccc
aagattctagcccaactccaacaagagctggaccaagtngtgggncnggaccgnctngtaaccgantcngacntgcccaa
cttgacctacctccaagcngtnatcaaggaaaccttncggctncacccntcnaccccgctctctcttcctcgaatggcgt
ccgagagttgcgaaatcaacggattccacattcccaaaggcgccactctcttggtcaatgtatgggccatatctcgcgac
ccggcccaatggtcggaaccgctcgagttcaagcccgagcggttcctgtcgggcggcgagaagccgaatgtcgacgttag
ggggaatgacttcgaggtcataccgttcggggctgggcgtagaatatgtgccgggatgagccttgggttgcgaatggtgt
ctctgatgactgcaaccctggtccatggttttgattggaccttggctgatgggttgacccctgagaagttgaacatggac
gaggcctatgggctcaccctacaaagagccgcaccgttaatggtgcacccgcgtaacaggctagcccctcatgcatataa
tgcatcatcatcttga
back to top
>JX403950.1-F3H.m11095
atggctcctgctactacgctcacatccattgcgcatgagaaaaccctacaacaaaaatttgtccgagacgaagacgagcg
tccaaaggttgcctacaacgacttcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggtggaaggccgcc
ggcccgagatttgcaagaagattgtagcggcttgtgaggactggggtgttttccagattgttgatcatggagttgatgcc
gagctcgtatcggaaatgaccggtctcgctagagagttctttgctttgccatcggaggagaagctccgcttcgacatgtc
cggtggcaaaaagggtggattcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtgacct
acttttcatacccgattcgccaccgggactactcgaggtggccggacaagccggaggcatggagggaggtgacgaagaag
tacagcaatgagctgatggggctggcatgcaagctcttgggggttttatcagaagccatggggttggatacagaggcatt
gacaaaggcatgtgtggacatggaccaaaaagtcgtcgtgaatttctacccaaaatgccctcagcccgacctaacccttg
gcctcaagcgccataccgacccgggcacaattacccttctgcttcaagaccaagttgggggcctccaggctactcgggat
gatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatcatggtcattttctgag
caatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagtagcaggctgtccatagccacattccaga
acccagcgcaagaagcaacagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccaatcacctac
accgagatgtacaagaagaagatgagcaaggatcttgagcttgccaggctgaaaaaactggccaaggaacagcaactgca
ggacttggagacagccaaagtggatacaaagccagtggacgacatttttgcttag
back to top
>KC460396.1-F3H.m11095
atggctcctgctactacgctcacatccattgcgcatgagaaaaccctacaacaaaaatttgtccgagacgaagacgagcg
tccaaaggttgcctacaacgaattcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggttgaaggccgcc
gggccgagatttgcaagaagattgtggaagcttgtgaggactggggtattttccagattgttgatcatggagttgatgcc
gagctcgtatcggaaatgaccggtctcgctagagagttctttgctttgccatcggaggagaagctccgcttcgacatgtc
cggtggcaaaaagggtggattcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtgacct
acttttcatacccgattcgccaccgggactactcgaggtggccggacaagccggaggcatggagggaggtgacgaagaag
tacagcgatgagctgatggggctggcatgcaagctcttgggggttttatcagaagccatggggttggatacagaggcatt
gacaaaggcatgtgtggacatggaccaaaaagtcgtcgtgaatttctacccaaaatgccctcagcccgacctaacccttg
gcctcaagcgccataccgacccgggcacaattacccttctgcttcaagaccaagttgggggcctccaggctactcgggat
gatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatcatggtcattttctgag
caatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagtagcaggctgtccatagccacattccaga
acccagcgcaagaagcaacagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccaatcacctac
accgagatgtacaagaagaagatgagcaaggatcttgagcttgccaggctgaaaaaactggccaaggaacagcaactgca
ggacttggagacagccaaagtggacacaaagccagtggacgacatttttgcttag
back to top
>HM775218.1-F3H.m1415
cccgacctaacccttggcctcaagcgccataccgacccgggcacaattacccttctgcttcaagaccaagttgggggcct
ccaggctactcgggatgatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatc
atggtcattttctgagcaatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagtagcaggctgtcc
atagccacattccagaacccagcgcaagaagcaacagtgtatccactctgtgtgagggagggagagaagccgattctcga
ggcgccaatcacctacaccgagatgtacaagaagaagatgagcaaggatcttgagcttgcgaggctgaaaaaactggcca
aggaacagcaactgc
back to top
>AF497633.1-F3H.m11095
atggctcctgctactacgctcacatccattgcgcatgagaaaaccctacaacaaaaatttgtccgagacgaagacgagcg
tccaaaggttgcctacaacgacttcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggtggaaggccgcc
ggcccgagatttgcaagaagattgtagcggcttgtgaggactggggtgttttccagattgttgatcatggagttgatgcc
gagctcgtatcggaaatgaccggtctcgctagagagttctttgctttgccatcggaggagaagctccgcttcgacatgtc
cggtggcaaaaagggtggattcatcgtgtccagtcatttacagggagaagctgcgcaagactggcgtgaaattgtgacct
acttttcatatccgattcgtcaccgggactattcgaggtggccagacaagccggaggcatggagggaggtgacgaagaag
tacagcaatgagctgatggggctggcatgcaagctcttgggggttttatcagaagccatggggttggatacagaggcatt
gacaaaggcatgtgtggacatggaccaaaaagtcgtcgtgaatttctacccaaaatgccctcagcccgacctaacccttg
gcctcaagcgccataccgacccgggcacaattacccttctgcttcaagaccaagttgggggcctccaggctactcgggat
gatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatcatggtcattttctgag
caatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagtagcaggctgtccatagccacattccaga
acccagcgcaagaagcaacagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccaatcacctac
accgagatgtacaagaagaagatgagcaaggatcttgagcttgccaggctgaaaaaactggccaaggaacagcaactgca
ggacttggagacagccaaagtggatacaaagccagtggacgacatttttgcttag
back to top
>AY965342.1-F3H.m11095
atggctcctgctactacgctcacatccatagcgcatgagaaaaccctgcaacaaaaatttgtccgagacgaagacgagcg
tccaaaggttgcctacaacgacttcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggtggaaggccgcc
gggccgagatttgcaagaagattgtagcggcttgtgaggactggggtgttttccagattgttgaccatggggttgatgcc
gagctcatatcggaaatgaccggtctcgctagagagttctttgctttgccatcggaggagaagctccgcttcgacatgtc
cggtggcaaaaagggtggcttcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtgacct
acttttcatatccgattcgtcaccgggactattcgaggtggccagacaagcctgaggcctggagggaggtgacaaagaag
tacagtgacgagttgatggggctggcatgcaagctcctgggggttttatcagaagccatggggttggatacagaggcatt
gacaaaggcatgtgtggacatggaccaaaaagtcgtcgtgaatttctacccaaaatgccctcagcccgacctaacccttg
gcctcaagcgccataccgacccgggcacaattacccttctgcttcaagaccaagttgggggcctccaggctactcgggat
gatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatcatggtcattttctgag
caatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagtagcaggctgtccatagccacattccaga
acccagcgcaagaagcaacagtgtatccactctgtgtgagggagggagagaagccgattctcgaggcgccaatcacctac
accgagatgtacaagaagaagatgagcaaggatcttgagcttgcgaggctgaaaaaactggccaaggaacagcaactgca
ggacttggagacagccaaagtggacacaaagccagtggacgacatttttgcttag
back to top
>AY965341.1-F3H.m11095
atggctcctgctactacgctcacatccatagcgcatgagaaaaccctgcaacaaaaatttgtccgagacgaagacgagcg
tccaaaggttgcctacaacgacttcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggtggaaggccgcc
gggccgagatttgcaagaagattgtagcggcttgtgaggactggggtgttttccagattgttgaccatggggttgatgcc
gagctcatatcggaaatgaccggtctcgctagagagttctttgctttgccatcggaggagaagctccgcttcgacatgtc
cggtggcaaaaagggtggcttcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtgacct
acttttcatatccgattcgtcaccgggactattcgaggtggccagacaagcctgaggcctggagggaggtgacaaagaag
tacagtgacgagttgatggggctggcatgcaagctcctgggggttttatcagaagccatggggttggatacagaggcatt
gacaaaggcatgtgtggacatggaccaaaaagtcgtcgtgaatttctacccaaaatgccctcagcccgacctaacccttg
gcctcaagcgccataccgacccgggcacaattacccttctgcttcaagaccaagttgggggcctccaggctactcgggat
gatgggaaaacgtggatcaccgttcaaccagtggaaggagcttttgtggtcaatcttggagatcatggtcattttctgag
caatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagtagcaggctgtccatagccacattccaga
acccagcgcaagaagcaacagtgtatccactctgtgtgagggagggagagaagccgattctcgaggcgccaatcacctac
accgagatgtacaagaagaagatgagcaaggatcttgagcttgcgaggctgaaaaaactggccaaggaacagcaactgca
ggacttggagacagccaaagtggacacaaagccagtggacgacatttttgcttag
back to top