F3H, F3H (gene) Pyrus x bretschneideri

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Pyrus x bretschneideri
Synonym flavanone 3-hydroxylase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HKF438228.1-F3H.m1Pyrus x bretschneiderimRNA
F3HKF438227.1-F3H.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HPyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KF438228.1-F3H.m1 scaffold00029:280845..282974
KF438228.1
mRNA parsed from NCBI nr database KF438227.1-F3H.m1 scaffold00029:280845..282974
KF438227.1

Sequence(s):
>KF438228.1-F3H.m11098
atggctcctcctgctgctacgctcacatccattgcgcatgagaaaaccctacaacaaaaatttgtccgagacgaagacga
gcgtccaaaggttgcctacaacgaattcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggttgaaggcc
gccgggccgagatttgcaagaagattgtggaagcttgtgaggactggggtattttccagattgttgatcatggagttgat
gccgagctcgtatcggaaatgaccggtctcgctagagagttctttgctttgccatcggaggagaagctccgcttcgacat
gtccggtggcaaaaagggtggattcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtga
cctacttttcatacccgattcgccaccgggactactcgaggtggccagacaagccggaggcatggagggaggtgacgaag
aagtacagcgatgagctgatggggctggcatgcaagctcttgggggttttatcagaagccatggggttggatacagaggc
attgacaaaggcatgcgtggacatggaccaaaaagtggtggtgaatttctatccgaagtgccctcagcccgacctaactc
ttggcctcaagcgccacacggatccgggcacaattacccttttgcttcaagaccaagttggtggccttcaggctactagg
gatgatgggaagacatggatcaccgttcaaccagtggaaggagcttttgtggtcaatctcggagatcatggtcattttct
gagcaatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagcagcaggctgtccatagccacattcc
agaacccagctcaagatgcaatagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccgatcacc
tacaccgagatgtacaagaagaagatgagcaaggatcttgaggttgccaggctgaaaaagctggccaaggaacagcaact
gcaggacttggagaaagacaaagtggagataaagccagcgaatgacatatttgcttaa
back to top
>KF438227.1-F3H.m11098
atggctcctcctgctgctacgctcacatccattgcgcatgagaaaaccctacaacaaaaatttgtccgagacgaagacga
gcgtccaaaggttgcctacaacgaattcagcaacgaaattccgatcatctcgcttgccgggatcgatgaggttgaaggcc
gccgggccgagatttgcaagaagattgtggaagcttgtgaggactggggtattttccagattgttgatcatggagttgat
gccgagctcgtatcggaaatgaccggtctcgctggagagttctttgctttgccatcggaggagaagctccgcttcgacat
gtccggtggcaaaaagggtggattcatcgtgtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtga
cctacttttcatacccgattcgccaccgggactactcgaggtggccagacaagccggaggcatggagggaggtgacgaag
aagtacagcgatgagctgatggggctggcatgcaagctcttgggggttttatcagaagccatggggttggatacagaggc
attgacaaaggcatgcgtggacatggaccaaaaagtggtggtgaatttctatccgaagtgccctcagcccgacctaactc
ttggcctcaagcgccacacggatccgggcacaattacccttttgcttcaagaccaagttggtggccttcaggctactagg
gatgatgggaagacatggatcaccgttcaaccagtggaaggagcttttgtggtcaatctcggagatcatggtcattttct
gagcaatgggaggttcaagaatgctgatcaccaagcagtggtgaactcaaacagcagcaggctgtccatagccacattcc
agaacccagctcaagatgcaatagtgtatccactcagtgtgagggagggagagaagccgattctcgaggcgccgatcacc
tacaccgagatgtacaagaagaagatgagcaaggatcttgaggttgccaggctgaaaaagctggccaaggaacagcaacc
gcaggacttggagaaagacaaagtggagataaagccagcgaatgacatatttgcttaa
back to top