F3H, F3H (gene) Rubus sp. SSL-2007

Gene Overview
Name F3H
Gene Symbol F3H
Type gene
Organism Rubus sp. SSL-2007
Synonym flavanone-3-hydroxylase
Description NA
Comment RsF3H
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
flavanon 3 beta-hydroxylaseF3HRubus sp. SSL-2007gene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
F3HEU123532.1-F3H.m1Rubus sp. SSL-2007mRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU123532.1-F3H.m1 N/A EU123532.1

Sequence(s):
>EU123532.1-F3H.m11098
atggctcctacacctactactctgaccgccatagcgggggagaagactcttcaacagagcttcgtccgcgacgaagacga
gcgccccaaggtggcctacaaccaattcagcaacgaaatcccgatcatttcgctctccggcatcgacgaggtcgaaggcc
gccgtgcagagatttgcaacaagattgtcgaggcctgtgaggactggggcgttttccagattgttgatcatggcgtcgac
gccaagctcatatccgaaatgactcgtctcgctagagacttcttcgctttgccaccggaggaaaagctccggtttgacat
gtccggtggcaaaaagggcggcttcattgtctccagccatttacagggagaggcggtgcaagattggcgcgagattgtga
cctacttctcatacccggttcgccaccgggactactcgaggtggcccgacaagccggaagggtggagggcggtgacgcag
cagtacagtgacgagctgatgggtttggcatgcaagctgttggaggttttatcagaggccatgggtttagagaaggaggc
attgacaaaggcatgtgtggacatggatcaaaaagttgtggtcaatttctacccgaaatgcccccaacccgacctcactc
tcggactcaagcgccacacggatccgggtaccattacccttttgcttcaagaccaggttggtggtctccaagccactaga
gatggtggaaagacgtggatcaccgttcaacctgtggaaggagcttttgtggtcaaccttggagatcatggacatttttt
gagcaacgggagattcaagaacgccgatcaccaagcagtggtgaactcgaaccacagcaggctgtccatagccacattcc
agaaccctgcacaggaggccatagtatacccactcaaggtgagggagggagagaagcccattttggaggagccaatcacc
tacactgagatgtacaagaagaagatgagcaaggaccttgagcttgccaggctgaagaagcttgccaaggaacagcaacc
tgaggactcagagaaggccaaacttgaggtcaagcaagtggatgatatttttgcttga
back to top